Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10132  (registered. 2012)
Contig Information
Length 1185 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|224579186|gb|ACN58180.1|| leucine-rich repeat protein [Dasypyrum villosum]
Score 491
Evalue 5.00E-137
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10132
TATTATATGTCATGGTGGACAAACACAGATCAAAGTTTTCCCATAAATTACTTACAAAAGGTCGCATAATCATAGGAATTTTAGCCTATACAGTAAGAAC
ATGACGTAGGATGGAACGCAGTGCCAAGTAAAAGGTATGTACTTGTTTGACATCCAACAAAGTTATCCTGTTGCATTAACATTTCTTTTCTCTACCCCGA
CTAACATGCTGTACACACCCTTGATTTGAGAACACAGTTTAACTGTGAAGTAGACTACCCCGAACAAAATGAAGAGAAGAATGAGCATAATTGAACAATG
TAAATACCAAAATTATCTTCTCAAATTCATTTGATCCTCAACCGTCTGAACAACTCATGTATCCAGTTCATATGCAGTCACCCAATTCTTGTATTTGACC
CTCAGACCTTCTTTTCACTTTTGCCATTGAAGAAAATGCTCAGAAGGAAATGTCTCTCGTATCTCCTTCACGTTCTGGAGCTCTGTAAGAAAACCCTAGT
TCCTCGCCTGATTGCCGCCTTACTATGCTAGCCCTCTGCATCAGGCGCACAAGTTGCTGGACAACCTCGGACATAGGAGGACGGAACTCTGGCTCCGGCT
GAACGCAGAGTGCAATTATGTCTGCAAAGCGAGAGAGTGATTTCGCAGGGTACATTCCATTCAATGCTGGATCAACCATCTTAGAAAGTGCATCAATATC
ATGAAGCTGAGGCGTAGCCCATCTAACAAGAGACTGTTCTGACCTCTCTCTAGAACTGTCTAGTGGCTTCCTTCCGGTCAATAGCTCTAGCATCACTACT
CCAAAACTGTACACGTCACTCTTTACAGTATAAATTCCTGACATGGAAAACTCTGGGGCACTGTATCCAAATGAGCCAACCACTTCGGTAGAAACCTGTC
TCTCGGTATTGGGTGTCAAGGCAGCGAGCCCACAGTCAGATAAATGTGCATTATGCTCTTCATCAAGTAGGATGTTTGCGGACTTAAAATTTCTATGAAC
AACAGAGGGCAAGCACACCTCATGCAGGTATTCTAATGCCCGAGCAGTGCCTAGTGCTATTCTTACACGGATGTTCCATGTAAGTCTTCTGCTCATCTCA
TCAGAGAAGTGCAGCATATCATGCAGCGTTGCATTTCCAATGTACTCATAAACAAGAAGCCTTTGGGCATGCTCCACACAGTACC
page-top