Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10122  (registered. 2012)
Contig Information
Length 879 bp
Clones alternative view 11 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 3
Wh_yd Spikelet at late flowering 3
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|3023751|sp|Q43207.1|FKB70_WHEAT|FKB70_WHEAT RecName: Full=70 kDa peptidyl-prolyl isomerase; AltName:
Score 436
Evalue 1.00E-120
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10122
ACACACTATAATATGCAAAGGTCTAAACATGCATTGTTCTTGACAAGAAAAAATATTGCCTGGCAACCTCAAAACTGAAATTTCTCTAGTTTTTAGCAAC
TCCAAGCACATGCGTGGTCTAACCAGCCCATAGAGCTGAGCAGACAAGCTGGCCCTTCCGTGAGCGCACTCCGGGACTCCTATCCTTCCTTTGGGTACTG
CTCCAGTTCAAGCTTTGCTTTCTTCTGCTGAAGGCTTGGTCATCTTAGAGAACATATTGCTGTAGAATTTGGCATCCTTCTTGTTGATTTCCTTGATCTT
TTCCTTCAGAGTCTTGTATGTCAACTTCACATCCCTGTTTTCAGGATCTATTTCCAATGCCTTCTTAATGTCGACCTCTGCTAACTCTAGGTCCGCAAGC
TGAGTGTAAGCTTGAGCCCTTCTGTACAAAGCCTTAACATTTCGGCTGTCCAGTTCCAGAACCTTGGTGCAAAGCTTTTCAGCTTGCTTATAGTCTTTCA
GCTTCAACTTGCAGGCAGCATTGTTTAAGTTGCAGGTGATCTTCAGTTGCTTGGATTGCTTTTTCTCATCCTCACTGAACGAAGTGTCATACTCAATGAA
CTTTGCAGCCTTCTCATAACGCTTGGAAGCTCTGGCATATTTGCCTGACTTGAACAAGGCATTCCCCTCTTCTTTCTTGGTTCCAGCTGCCTCAATCTTC
TCTGAGTTGTTCAAGTCCCATGACTCCTTATCCTTTACAAATGATACAAGCTCCACTTCGTAAATCACAGTACTGTTAGGTGGAACTATAGCATCCTGCT
TCGACTCCGTTGAGCCATAAGCATATTCAGGAGGAATAGTGACAAGAGCAACCTCGCCCTTCTTCATGTTTAGCACAGC
page-top