Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig5951  (registered. 2007)
Contig Information
Length 435 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Theileria annulata] >gi|65305673|emb|CAI73998.1| hypothetical protein [Theileria annulata]
Score 84
Evalue 0.54003
Total Hit Count 3
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig5951
GAGACACTTAGAGATCCGAGTGGCATGTCGGTAGAATGCTTCGGGCCTTTGGTAGTTTTGTTTCTGAACAAACGGGCTAGATCCTCCTGTACTTCGTTTC
CTTCTATCATTTGACATCAGAATGATAAACAGACAGACTGGTGCTTGCTCAACTTGTCCTGATGTCCAGCTTATTACTCCCTCTGTCCTGAATTACTTGT
CTCGGCTTTGTCTTGACGGATGTATGTAGACATGGTTTAGTGTCAGATACATCCGTATCTGAAAAAATGTACTCCCTCTGTCCCACAATATAAGAGCCTT
TTTGACACTACACTAAGTGTTAGGAACGCTCTTATATTATGGGACGAAAATGCTCTTATATTATGGGACGGAGGGAGTAAAAGACAAGTAATTTGGGAAG
GTATAATACCTTTTTACCTTTGTTCAAAAAAAAAA
page-top