Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig5850  (registered. 2007)
Contig Information
Length 1252 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_V483 Shoot grown under cold condition for 3days 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative G protein-coupled receptor [Arabidopsis thaliana] >gi|23198212|gb|AAN15633.1| putative G protein-coupled receptor [Arabidopsis thaliana]
Score 384
Evalue 1.05209e-51
Total Hit Count 43
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig5850
TATGGTAACCCATTTTTTGTGTTGCTATTTTCAACCCTGCCTATGCCAGTGCCAATTTCTGTTGTTTGTCCAATCAGATGCTCATGCCTATGTATCTCGA
AAATGAGTACGCGTGATTTCATTTGCTGGCCTCATATAGTTGGAACTGGTAACTAGCCATGTTAGTAACTTGTGCTGCAGATTTTGTCTATGTATCATCT
GAGTTTACCGCCCTAGGTACCCTTTATTATATTTCCGGACTAGTTCATATTATGTGTATATGGGTTGCTTTAAACATAGAGCCTCCTTTTTTTGATTCCT
CAGGAACTTCACTAGTTACAACTGTATTACGTTCAATAGGAAGTGATTATGGAAGGCCAGGGACCTGGTGTTGGATCCAGCAGGGAAGCACGGGAAAGAT
TTTACACTTGATTACCTTTTACCTTCCACTTTGGGGTGCCATTCTCTACAATGGGGTTTTACGTACTATCAAGTAAACCGCATGTTGAACAATGCGACAC
GGATGGCTGTTGGCATGAGTGATCGATCAAGTCAATCTGACGTGAGGGCAGACAAGAAGGCATTTAACCGGTGGGGTTATTACCCTCTGATTTTAATTGG
TTCATGGGCTTTCGCAACAATCAATCGCCTGTATGACTTTGCTAATCCTGGTCACAAGATATTTTGGCTATCCATCCTTGATATTGGGTTTGCTGGACTT
ATGGGCCTTTTTAATTCGATTGCTTATGGGTCTCAACTCTTCAGTGCGCAGAGCAATTGCAGAAAGAATTGACATGTATCTACCCGAGAGAATCAAAAGG
AGCCTCCCTACTTTGTCAAGATTGAGAAGTCAGCAAGAAAATGAGCTGACCTCTCTTATTGTTGAGAGTAATAACAGTATAACAGAAACAACAATGCGAG
TAACACCTAGGAGTTCTCTAGCTGGCTGAGTTTGTTCATATCTTTCGGGCTCTTCGTCAAGAGGGCGGTTTATTAGTGTGTACCATTTACATCACTGTAG
GAGCAGATGCTTAGCACTTACACTGACCATTTGGCATATCAGGTTGTCCGCGGTACATAAGAGGTTGTTTTAGGAGATAGCCAACAGTGGGTAGATACTT
AGGTAAGTTGGTGTGGTTGCCGTTATTCTTGCCCCACCCTCATGTTGTACTTCTTGAGAACTCGTCTCATCGGTTTGGCGAAACTGACTACGGACTGATT
GCTCTTGTATACTAGCACTGTTCCATACAGTTCTTAACCCCTTTGGGGTATG
page-top