Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig5764  (registered. 2007)
Contig Information
Length 857 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit avenin-like protein [Triticum aestivum] (no hit)
Score 665
Evalue 8.25931e-68
Total Hit Count 0
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig5764
GTTTTTTCAGTGTGTCGATTTGCCTAACTATGCCTTGTTGATTACTGATTTTGTTACTAATGTGTACACAAACCCTGCCTAATTAATTTAGTCCACTATA
TCTAACCATATGAAAGTGAAAGTTGATTCTGACTACTTGCCTGGTGGTACGGTACATTACCTCTTTTTCAAATTATGAGAGCGGAACGACAGCGTTGGCG
TGGACGACTCGGAGCTCAACCCCGTCAAGGGCCGCGAGCAGGAGCGGCTTTCTTTTCAACAAGAAGATGACCAAGGTCCAAGGGCGCCGCCAGCCACTTT
GTCGTTGTCATCGAAGAGTCCAAGATTGTCCCCGCATCGGTTGCATTGGTGCCGATCAGGTCCAGGTCTGCGCGGTTGGGGCGTCAATCACGTGTTCAGC
GGCATGTCAGAGCAACTCTCTGGCCAGAACCCTGACTATGTGCGCTTCAGGGAAATGTGGACGCTGGATATCCATTTCTTAGGTGTCAATCTGGTACTTA
GGCTGTGTAATACAGGGCAGAGTTCTTCCAGCTACTAATTCACGTAATCTGATTTATAGCCTAGGCACTTTTCTTTAAGCATAGTTACCTATTCGATGGT
GACCAACCATCCGTCACACGCGCCATACAAACAATTCAGGAGGAGGCCCGCTTGTGAGCATGCGCCGGCGCCAAAGGCCTTGCGGTCATCATCCCGGAGA
CGCAGTCCTGGTCCATCGTGGGAGGCGCTTCCACAGAGATCCATGCGTCGAGGCAGCTTACTCATGCCATCCATGCGCACATGCTTGTAGGCGGCCTTTT
GTTGCGGCATATATCCTGTAACAACTAAACCCTGTATTTTCACACTCTCCTATCAAT
page-top