Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig5720  (registered. 2007)
Contig Information
Length 1207 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os10g0457400 [Oryza sativa (japonica cultivar-group)] >gi|110289183|gb|AAP54098.2| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|113639371|dbj|BAF26676.1| Os10g0457400 [Oryza sativa (japonica cultivar-group)] >gi|215693383|dbj|BAG88765.1| unnamed protein product [Oryza sativa Japonica Group]
Score 605
Evalue 1.35183e-60
Total Hit Count 200
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig5720
CGGATCCATCGACCGACCAAATCCCTCTCTCTCTCCCCCAAGCTTCCGGCTCCCCAATCTCTCCCCTTCCCTTCTTGGCGACCCACTCTTTGGCCGTCCC
CGTGACCGAAATCCCATGGAGACCGCCGTTCTTGCGCCACAGCAGGTCAACCCGGCTCAAGCGGCGGTGCCGCAGACCAGGAACGCGGCGGCCATGGCCG
CCATGCGGAAGCTCGGCGCCACCTCGGCGAGGAGGAAGACGCTCTGCGACATCACCAACCTGAGACGGCCGCTGGAGGCGGCGGCCGATGAGGGGCATCA
GGACGGGTCGAGGTGCGCGGACGGCGTGGATGCAGTCGCGCGGTTGGTCAAGGAGAACTCGGATCTTGTGAAGCTCCTGGAGGAGAGAGACAAGTTCATA
GAGCTGAGCGGGGCTGAGCTCCAGAATCTGCGGCTGGCAAACTGGCAGCTTGCGCAGGCTAATTCCCAGATGTTAGCAGAGCTAAATCTTGGCAAAAATA
GGCTGAAATCGCTACAACATGAGCTTACCTGCTCCAGAGCTGCCCTCAAAGTAAAATCATCGGAACTTGAGGAGGCAAAGAAAGCGCTGAAGAGCAGCAG
ACTCCAGCAACAGAAGAGCGCGAACGAGACGGCACGCCACTTGGCTGCCGACAGAGCTGCAGCAGCTGCACAGCTCAAGGATGGAGACGCGGAGCCCGCT
TCGGATGCGTCGCGTGCCGCCAGTGCCAAGAAGTCTACCTGCAACGCCAGCCGGAAGAGGCTGCTGAGATCTCGATCTCTGGGACCTGCGGTGGCGCCGA
CGAAGCTGGTGGCGGCGTCCAAGGAGAGGGAGAGCGCACAGAGGCGCAAGTCCATGAGAACGCCTCAGCCGAGTGGGCGCAGGGAAGACTTGTTCGAGAT
AGAGGACGTTCAGCTCACCGCCGGCGGTGGAGATGACAAGAAGGAGACGTCGTGGGAGCTGGATTCATCGGTGCAGTTCCCACGCAGGTCGTCGCTGGGG
AGGCCGCTCCGGCGGGCCACAGAGAAGGTCACCTCCTACAAGGAGATGCCTGTCAACATTAAGCTTAGGAGGCCCTAAGCAGTAGCACAAGTTGGTTGCA
GTTTTTTGCATCCAGTTAGATTATGTATAATGAGTTAACTTATTCTTTGCTGCCTTCTGCTTCTGCAGATGCGCAGCCAGCGTGTGTTTGGTGTGAAAAA
TCTGGAT
page-top