Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10085  (registered. 2012)
Contig Information
Length 835 bp
Clones alternative view 40 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 6
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 5
Wh_r Root 2
Wh_yd Spikelet at late flowering 8
Wh_KMP Shoot grown under continuous light 1
Wh_SHC Shoot grown with cold treatment 1
Wh_VSCB Liquid cultured tissue 5
WH_SP 1
WH_XA Root 3
WH_XB Root 3
WH_XC Root, treated at 50 microM Al for 6h 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|122044864|sp|P05621.2|H2B2_WHEAT|H2B2_WHEAT RecName: Full=Histone H2B.2
Score 244
Evalue 6.00E-63
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10085
TTTTTTTTTTCAAACTTCAAATAGTACGCTAGATTTAAAATTAGAGGTTTCTATCTGTCGATCTGGAACATAATTAAATTATCACAGTAGATAAAATGGC
AGCAAATTAAAATTAGATAAACTATCACAGTAGAAACTTGCTGACATAAACAAATAGCATCAAGAAGAGTCTGAACTCTGAAGCGACACGCAAGCACAGA
CGAACATTGATTCAAACAGCAACATCACTATTTCTTCAAGGCCGCAAGCAGCACAATTCTTACAGAGATTGTAACATCGTACTGCTGCCAACTACATGCA
CGACGCCTGCCGCCATCAATCCATGAAACAGACGACGAAACCTATGATGATGTGAACTTGGTGACGGCCTTGGTGCCCTCGGAGACGGCGTGCTTGGCGA
GCTCGCCGGGGAGGACGAGGCGGACGGAGGTCTGGATCTCCCGGGACGTGATGGTGGGCTTCTTGTTGTATCGCGCCAGCTTGGCGGACTCGCCGGCGAG
CTTCTCGAAGATGTCGTTGATGAAGGAGTTCATGATGGACATGGCCTTGGAGGAGATGCCGACGTCCGGGTGCACCTGCTTGAGCACCTTGAAGATGTAG
ATCTTGTACGTCTCCACGCCCTTCTTGGCCTTGCTGCCCTTCTTCCGGCCCCTCGTCTTCCCCTCGCCGCCGGCCTCCTTGGTCGCCGCCGCCCGCTTCT
CCGCCTTGGGCTTCTTCCCCGCCGCCGTCTTCTCCGCGGCCACCGCCACCGGCTTCTTCTCCGCCGCCTTGGGTGCCATGGGTGCTGGTGGTGGTGGTGG
TTCGAGCGTGGGGCTTGGCGTGGGATGTGAGGGGA
page-top