Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig5699  (registered. 2007)
Contig Information
Length 676 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PEGA [Methanospirillum hungatei JF-1] >gi|88189008|gb|ABD42005.1| PEGA [Methanospirillum hungatei JF-1]
Score 80
Evalue 3.77621
Total Hit Count 2
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig5699
CTCCTATCCTTATTCTCTCAGCTGACCCACAAATTGCAGCTACCGGTCAGATCCAATCAGTTTGCTTTCTTTACTCGCTGCATTGAGGTTGCTTGTCCTC
CACCTGAATCCACTCCGCAGCTGGTTCTGCTACAGGTTTAGCATCGACGGCAGCTGGTTTGGCTGCTCGTACGCCTCATCGGTCTCTTGTAAATGGCGAT
GGAGGGTAGCAGGCCTCAAGGATTAGCTGCGCCAGGGAGATAGCGAGATCGACTTGGTCATGGATTTCATCTCCTGCGGGCTCGCAGTCCTCTTGGATCC
AGCTTTAGTATGAGGATGCTGACGGCGTTTTCTTCCCCAAGAGCGCAAGCCAGAAGCATCGTCTATATATCGGCTCGAGGCAGCTCGGCACTTCACAGCA
ACATTATTCGAAGTTCAACCTGCAGGTAGTTGCTTTGCGTACTATCGCAACTCAGATGGAGCTGGTGGCATCAAGACATGAACCCACTATCGAATTTAAG
GTCTGATCTATAATTTCATGAAGATTGTACCTGGAGGTGGTTTGATTGCTCGACGGAGCCGGCTGGTGCCTGCTGGAGGAAGACAATGAAGTTGACCTCG
AAGAACATGAGATTTTGGTTGTATGTGGACTCTGAAGAGATATTCTTCTATTTGGAGAGATTGAATCTCTGTACAT
page-top