Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10084  (registered. 2012)
Contig Information
Length 941 bp
Clones alternative view 74 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_dL Crown of seedling 8
Wh_r Root 7
Wh_CSEC Callus 1
Wh_EM Dormant seed with water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 8
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 3
Wh_SHC Shoot grown with cold treatment 3
Wh_VSCB Liquid cultured tissue 7
Wh_VWD Shoot grown with dessication 3
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XT Roots, 18 day old plants were grown hydroponically 3
WH_SP 8
WH_XA Root 4
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115475908|ref|NP_001061550.1|| Os08g0326400 [Oryza sativa (japonica cultivar-group)]
Score 499
Evalue 2.00E-139
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10084
GATGTTTCAGACAAACAAAAATGACTTTCAAAACTGGAGCCAAACTGCCACAGTATGCTTGCACACTACTCAAGGATGAGGAATAGATATGGTTCAACAA
TGCTAAACTTAGTTCATCCGCTGCGCAGCCTCCTTTGCGATAAGCCTTTCCCTGGCCTTGGTCTTCGCTTGCGACTTGGAGCCCATGACACCACCACCCC
ACTTCTTCCTAACCTCGTCGAATTTGTCGTTGAAGTTCGCCTTAATAGCCTCAAGGATCTTGCTGAACTCAAGCTTATCCTCATTCTTCACTGTGGTCAG
GCACAGAACAGAGGCAGTCTTCTTGTGAACAATCGATCCAAGGCGAGATTTTCCCTTGACAATGCAGTAAGGGACCTCCATTTTCCTGCAAAGAGCAGGG
AGCCACACAACCAGCTCAATCGGATCAACATCATGAGCTATGACAACCAGCTGGGCTTTACTCTGCTCGATTAGGTAGGTAACATGGTTAAGGCCATACT
TCACAACTATTGGCTTCTTGGCCTCAACAGTTTTACCTTCAGCTTCAGCCTGGGCCCTCTTTAGAAGCCTCTCCTTCTTGGCAACTTTGTCTTCAGGCCG
GTACTTAAGAAGCATCTTGAACAAGTTTGTTGCAAGGTTCTTGTCGAGGGTGCGGGTGAACTGGTGGAGTGCCGGGGGCACCTTGAGGCGCTGCTTGAGG
ATGCGGCGCTGGCGCTGGATGCGCACAACCTTGGGCCACTTAACGAAGCGGTGGAGGTCCTTCTTGGGCGGGAGGGCGCCACCGATGCCGAATTGCTTCG
TCCTCTTCTCGAACAGCGGGTTGGTCACCTTCTCCGTTTTCTTCTTCGCCGGGACCGGCGCCTTGCCGCCTCGCTTAGGGGCCATTTCGCCGGCGGCTGG
TTGAGGTCAGCGGGGCGACGGCGAGGGGCAGACGCCTCGTG
page-top