Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1006  (registered. 2012)
Contig Information
Length 538 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_h Spike at heading date 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125542338|gb|EAY88477.1|| hypothetical protein OsI_09948 [Oryza sativa Indica Group]
Score 173
Evalue 7.00E-42
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1006
GCTGGTGCCCATACGTCCATTTTCTATTTAGGGCACACATACATACAGCTTACACACATGTCACAACGCACATCTAGTAGTAAGCACACATGGCACTCTT
GCACACATAAAATACGTATACATGTACTTACGTGGCCGCTACGCGTAGCTACGTACGCCCCGTATACCTTGCGGCCGAGACGTGTAGGCACTAGGCACGC
ACGTACGTACTAGCTAGCCATGCACTCCAGTGATGTTCCTCCGCTTGACCGTGACGGCGAGCCCGTTCTTCATGTGGAGAATGATGGACAGCTTCGGCTC
GACGACGTGGCCCGGCACGGTCTCGACTGCGAGGTTCCACAGCACGGCGGCGGCGGCGGTCTTCATCTGCACGAACGCCATCTCCTTGCCGAGGCAGGTT
CTGGGCCCGGCGTTGAAGGAGATGAACTTGTAGGACGGCTCGTACCTCAGCTTCCCGTCGGCGGTGACCTCGCCCTTGGGCCTGAACTNNATGCAGTCCT
TGCCCCACACGCCCTCCATCCTCGCCATGCAGTAGGAG
page-top