Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10058  (registered. 2012)
Contig Information
Length 1104 bp
Clones alternative view 25 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_e Seed DPA10 1
Wh_r Root 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_SHC Shoot grown with cold treatment 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_CA 1
WH_XA Root 2
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 7
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|16755057|gb|AAL26702.1|| 68 kDa protein HP68 [Triticum aestivum]
Score 442
Evalue 3.00E-122
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10058
TTTTTTTTTTATAGCGTGTACTGCCCACCACACNTCGTCTTTCATAAGACTAGTTCAAAAGGAACGGAACCAACTAGTGAGAGGACATAAAATACAATAT
GAGGATAAACTACTGAGAGGACTATAATAAGCTCCAAAAGAATATGCATTATAAGATTTCACGATAAAACAATATGAGATGGTAAAGCCATGATACAGCA
ATGCAAATACAAGAAAACTGATAATCGTTCTCCCCACAGCTCAAACCAACAAAAAATACAGTTTCAACACATGCACTTCTTTGAAACCCAAGCACCACAC
TCGATGCACTTCACTCCTGTGGCCAATTCACATGTCTCATGGACACACGTCATGGCAAGTTCTCGTTAGCCTCGCGCATGATCCGGAAGGGTTCAAAACA
TTATTGACGTCCAACAAGAATCTGTGTGCCCCCTCTCACTAGTCATCTAGGTAGTAGTAGGACCCTGCATTCTTTTGTTCTCTGTCCTTAGTAGATTCCA
GTTTGTTGATTCGTGGCCTGTAGTTGGTCGGGTCTCTTCTAAATGTAATGTCAAGATGCGATAAGAATTTATTCATCCCAGATACCAAAGACTGTGGTGC
ATTGGCAGTACAGTCAATAGAAGCAAGTCCCTCATAAACAATAACCTTGTCCGCTAAGTAGGTTGCCATAATGAAATCATGCTCCACAATAAATGCAGTT
TTCTTTGCATGAAGGATGAATCTTTTGATAACCTTCGAGGCAACAATACGCTGCTCTGAATCGAGATATGCACTTGGCTCATCAATTAAATAAATATCTG
CAGGCTTTCCAAGGCACAAACATAATGCTACTCTCTGGAGCTCTCCACCTGATAAATTAATAACTTCCTGGTCCATGAGTTGCTCAATTTGTAGTGGTTT
CATAACATCAGATACAAACTGAGGATGAGTATATGAATCGCGTATTTTCGAATGAAGCAAGTGCCTCACTGGATGCTGGAATTTTGGGCTGATCTTTTGA
GGCTTGTAGGACACATTGAATTCAGGAATTTCAACCTCGGTTCCTTCCATGGTATCTGGCTTCAACAACCCGGCCAGCACTCTGATGAATGTAGTTTTCC
CTGT
page-top