Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10049  (registered. 2012)
Contig Information
Length 1107 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 2
Wh_CSEC Callus 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_RDr Root of dessiccated seed 3
WH_XN Leaves, plant was grown at constant 23℃ 3
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|225593669|gb|ACN96318.1|| Di19 family protein [Triticum aestivum]
Score 438
Evalue 5.00E-121
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10049
TTTTTTTTTTGCTTCCACACAGGTGGAGCTTCTGTAATTTCCCATTGCATTGCATTCTATAGTATGTAACAGCTGTGTGATGTTGGTACAGACCAATGTT
CCTTGACAATGAAGAGGATGGCACAACAAGTTACAACCAAGGCAAGGAACTGCTGGGCGATAATTCGGTGGAAAAAACGGCAATATGGAACAGCTACCAT
AAATTAAGGTGTATGTGTCAAGTCCAAATAAAATCCGCACTTGACTACGGGTGCACCAGACGCACTTGCCTTCGCCCAAGTTAAGACTAACCACTCATGG
CGGAGTGCTGCTGTTCTATCCGAATCAGCGTGAAGGAAGCACCCATCTAACAAGGAAAATGCAGGGCCATTCGAGCACTCAGTCGTCTCCAAATAAAGTG
GAGAGGACCAGGTCTTGCACAAAGGTCGCCCTGCTTGTGGCTTGTTTCCGCTTTTGTTCCCTTTCCTCGCTTGTGAGGGACGAGTCAATGCTTGATTCCC
AAGGTTGAGGAGGCGCCTCCTTAAGAATTGAAGTATCATCGAGAACCGGAACTGATGATTTCGATGGTTCTTCGGCATCTGATGTTGCAAAACCCAGGCC
AAACGATGAAAGCAGTGGATCAGCATAGATATTTGTAGTGGCAGTGGTGGTGTTCCTTGACCTATGACTATGACCGCCTCCTAGAAGCGCCTTGAACAAG
TAACCATGATGCATGGTGATATGATTTAGCATATCTCTTGTAATCTTTTCAGAGCAGATGGGGCAAGGCGCGGGGTGTGGCTCGTAGGGGTGGTCCTCCT
CGAGGTGGACGCAGAGGGAGCCGAGGTCGTAGTCCTCGTAGCAGTAGGGGCAGGCGACCTCCGGCCATCTTGCCTCCTCCAGCTGCATCTCCATCTCCAT
GTCCATCTCCCCGTCGTCCTCCATGTCCATGTCCACTTCCTCCATCCCCATCCCCGCCATATCGTCGATGTGGCCGAGCTGCGCGGCGTAGAAGCGCTTG
GCGGCGGCGAGGCGCGAGATCCAGTGCTCCGAGTCCATGATTGGATTGGGTTCCTCTTCCTTCCTCCTCTTGGTTCCTGTGCTAGACGCGCTTACTCAAT
CAGCCGC
page-top