Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10043  (registered. 2012)
Contig Information
Length 1558 bp
Clones alternative view 72 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 20
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XA Root 22
WH_XB Root 18
WH_XC Root, treated at 50 microM Al for 6h 9
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|295841389|dbj|BAJ07108.1|| beta-glucosidase [Triticum aestivum]
Score 851
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10043
TTTTTTTTTTAATAAAAAACAGGCATGAAGCCCCACTTTATAGATAAGTCGGCGAGTTCCACAAATACATAGTTATCGAATACGAAGGTTCACCAAGCAA
AAAGGAAATAATTTGGGCTGGGTTGCAACACAGGTAAGCCCAACATAAAGAAAACAAACCAGAAGCCAGAGCGGGATGTTGAAGAGCTACACCCTCTGGA
GTCAATGCTACTAATTCAACATCACCGGTAGTAAATGTCCACATTCCTTCATTTTATTGCATCCATTGGATTACTTATTCTTCAAACTGCATACCATGCA
TTGAGCATTGGATTATTTATTTGAACATAACATTGCTTCTCCGTCACACGGGAGCTTGCCCAGTTGGCTTGGTAGTACCAAGCAAGTGTTTTGGGACGGC
GTTGAACTTGGCGAACCACTTGGCTGACTTCTTGAGCTTGCGCTTGAAGCCGTCATTTTTGTCAATGTAGACGAGGCCGAAACGTGAGCTGTAGCCGCTG
CCCCACTCGAAGTTGTCAATCAAACCCCAGGTGAAGTGGCCCCGTACGTCTGCGCCTTGGTCTATTGCGTCCTTGACTGCTGAGATGTGGCGCTGGAGGT
AGTCTAGCCTTTTCCAGTCATCCAACGGATCTGGCATGGTTTCGTCGCCGTCCACGTCAGCGATTCCGTTCTCAGTGATGAAGATGGGTGGGTTTCCGTA
TTTCTCCTTCATGATCAGAAGGAGGTCCGTTAGGCCTTTTGGGTACATGTAAATCCAATAAGTCCCAGTTATAGGACCGATGTCATTCCCGTCACTCCCT
GTAGTTTCTGAACTGGCGTAAGCGTCGTCGGTGTTCAGCTTTGGCGTAACGTCCGGTGAAATGTCAACATGCTTGGAGAACCTGGAGGTGTAATAATTGA
GCCCCATGATGTCACATGACGAGGCTAGCTTCTCTTGCTCCTCCTTAGTGAACACGGGTAGCCGATCTCCGATCAGTGATCTCATGGAGAAGGGGTAGTC
ACCATGAACCACTGGCTCCAGGAACCATCCGAGGTTGTAGTCGATGGATCTTTCCCGGGCCTGATCGTCGAGGAAGGAGTCTTGGTATGGCTCGTAACCC
ATTACGTCAAAAGCCATCCCTATTTTGGAATCTCCATGCATGTTGTAATGCGTTCGGAACATCTCAACAGCCTCAGCGTGAGCTAAGAGGATGTGGTGAC
CAGCAGTGTATGGCTCTCTGAGCGAGTCTCCTTCTGGGACGGCACAATCCATCCCCGGCGAGCACCTCCCAGGAGCATGAATCCCCTCTCCATAGGAGAA
ACAACAATACGTATGTGGCTCGTTAAAGGTGAACCAGTTCTTCACCCTGTCGCCGAAGCTCTCAAAGCACACCTTGGCGAATTGTTTGTAATCATCTACA
ATCTGCAGATCTAAGAAGCCGCCGTACTTGTCTTCCAGTGCTTGAGGGGTGTCCCAGTGCCAAATTGTAACATATGGCACTATGTCGTGACTTATCAGTG
AGTTGATCAGGTTATTGTAGTAGTCGATGCCTGCCTGGTTTACTTCCCCCGTCCCATT
page-top