Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig5112  (registered. 2007)
Contig Information
Length 505 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Vitis vinifera]
Score 74
Evalue 8.68079
Total Hit Count 1
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig5112
CCTCGTGCCGCTCTCTCTCTCTGTCACATTCGGCAAGTGGTCCGAAAATCGTGGTTCAGGAGAGGAATAAAGTGAGGGGAAAAGCATGACCATTTTTTCC
ATCACAGAAGCTGCACGCAAGGCACGTGTACATAGCGAAGGGGGCTTGTCGTCTGAATCAGGAACTTGCATGACATGTTTCATCTTGGCTGCGTTTGTCC
ATAACACGACATCGTTGACTCGAAGACCACCACTGCTGGGAACATTATGATTCCCGGGCTCACGGCAAAATCAAGCATAACTGCATCCACCGGAGGATAA
CTCCGGCATGTACTTAGAAGACTGAAAACGGCTATGCCATTTCAATTTTCTTCTTCTTTTCCACTGTTTTTGTGCTTAGGAATAACAGCTGACGAATGCG
GTGAAATTCGGGGTTTGCGTTGAGTTGAACCAGTCAGCCATTTGTGTAGCTGAATCTATAACCACCACGCGATGGCGCAATGATGATTCTTGTATAAAAA
AAAAA
page-top