Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig5099  (registered. 2007)
Contig Information
Length 630 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unnamed protein product [Vitis vinifera]
Score 166
Evalue 3.40545e-10
Total Hit Count 24
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig5099
CGGCGCTTTTCCACCCTGAATGTCTTCCACTGGACATCAATAATTTGCCAGGGGATTCATGCCCTATGCATGAATGCTACTCGTGCAAGAAAAAACATGC
AACATCAAAGGGTAACAAAACAACAGGAAAAACAAAGGGAAAAGGAACGTGCAGGAAAAAACATGCAACGTTGGAGGGTAATAAAACAATAGGAAAATCA
AAGGGAAGGGGAACGTGGGGAATGGACTTGGTGCTATGCAGGCGCTGCCCCAAAGCATTTCATCGGAAGTGCTTGCCAAGGAAAATCAATGGCGGTGAAG
GTGAAATAAAGAGGATATGGGAGACTGCGGGTGGGACTGTGTTCTATTGCAGGGATCATGAGATGGTAGAAAATCTCAGAAGTGCAAAGAGGAATCATAT
TAAGTTTCGAGAAGAAAAACCTAAAGGTGCGACTGAAAACCAAAGTGTTGAGGATGGGAACAAGTGAAGTGTTCCTGTTGCGAAAAATATGGCCGGACCT
GTGGTGGCCTCCCTCCATGATTTATCTTCCNACTTGTTGGANAAANGAANCTTGTCTTGNGCTCTTGNANAATCNCAAANATANTGANNTGANNACTTTG
GTGTCNTCTATNACNNATNNCNTTNTCTGC
page-top