Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10017  (registered. 2012)
Contig Information
Length 1031 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 4
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|84105094|gb|ABC54587.1|| mitogen-activated protein kinase [Triticum aestivum]
Score 472
Evalue 4.00E-131
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10017
TTTTTTTTTTCAGCAGTAACGCTTCTTGATATATTAAGAATTTTCGACAGCGAAACATGACAGCGTCAAGATGTCTTGCTCTGTTCGTTGTTACAATCAT
GCATAGATGATAGGTGTAGGAACTAATCCCAGTGTTACATTGAGTGTAAAAATACATCAATCCATGCAGGGCCAGCTCCTGTGTGCAGCAACGACGCTTG
ACAGGAACATGCACTCCGCTAAACCATCTCCAACTTGCAGTGCTTTGCTATCAGCTATCAGCATCCGGTGTACCTGACAGAAATGAGAAATGCGGTGCCG
ACTTCCGTCGTCGTTGCTGCACTAGGCATGCATCTTTGAGACCTTCTCGGATAGTCCATCGACGGCTCCTTCTGTTTCCTCAGAGATCGCGTCGTCATAC
TCTGGCTGTTTATTCGGGTTGACAACGACGCACTTGGAAGCGCTAATGCTCGCGCTCTTGAGGTAGGTCCGCGAGCTCAAGCTGGTGGGGCTCAGACCAT
TCTGGCCAACACCGGGTGCATCCTGTGACTTTTGAGGGCTCACTGCACCATGGGCATCAGGCTCTGCACTCATCTCCTGATCACTAATATGCTGCTCATT
ATTACCGTCGTTCGATGCACCTACCCTCTGCCTTGGTAAAGAGGCATGCTTTCTTTGCAGCGGAGAACCTCGTTCTCCTTTGCTGTAATGCTCCTCCAGG
TGTGCAAACTGCCGTTTAAAGCGGTCAACACCACTTGGATAGAGGAAGCTAATCTGGTCTCCACCTTTCATGTATTCCTCCAGCATCTGTGGATGGTACT
CCAAAATCTCTCGATAGATCAATTCCCTAACATCATCTTTTGTAACCTTTCGTCTCTCAAACTCAAACTCGAGTTTCGAAATTGGATGCCTTGATGGCTC
ACGCTCCACATTGGCAAGAGATGCAAAATATGGGTCTGCTAAAGCCTCTTCAGCTGAAGGCCGGTCTTTAGGATCAAATGCAAGTAAACGACCCAGTAGG
CGAACCGCCAATGGATCGGCATTAGGAAATT
page-top