Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig5019  (registered. 2007)
Contig Information
Length 1106 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0691700 [Oryza sativa (japonica cultivar-group)] >gi|18565419|dbj|BAB84606.1| putative phosphoprotein phosphatase [Oryza sativa Japonica Group] >gi|113533468|dbj|BAF05851.1| Os01g0691700 [Oryza sativa (japonica cultivar-group)] >gi|125571653|gb|EAZ13168.1| hypothetical protein OsJ_002993 [Oryza sativa (japonica cultivar-group)] >gi|215695520|dbj|BAG90711.1| unnamed protein product [Oryza sativa Japonica Group]
Score 901
Evalue 5.19933e-169
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig5019
CTCTCGCCACCCCCTTTGATTGGATCGAAAAACAAAATCGTCGCTCCCACCAAAATCCAATCCCCAATCCGCCGAAACCCTAGCGGCGAGGAACGGGAGG
CCGTAGCCGGGGGATTCCAGCACTCCGGCGACATGGATTTGGATCTGTGGATCGTCAAGGTCAAGGAGGGGCAGCACCTCGCCGAGCACGAGCTCCAGTC
CCTCTGCGAATACGTGAAGGAGATCCTCATCGAGGAGTCCAACGTGCAGCCGGTCAACAGCCCCGTGACGGTGTGCGGCGACATCCACGGCCAGTTCCAC
GACCTCATGAAGCTCTTCGCCACCGGCGGCCATGTCCCCGACACCAACTACATATTCATGGGCGACTTTGTGGACCGCGGGTTCAACAGCCTTGAAGTCT
TCACCATTCTTCTGCTTCTAAAAGCTAGGTATCCTGGCCACATAACCCTTCTGCGTGGGAACCATGAAAGCAGACAGTTGACACAGGTGTATGGCTTTTA
TGATGAGTGTCAGAGGAAGTATGGGATGCGAATGCATGGCGGTATTGCACTGATGTTTTTGATTACCTTACTCTTTCAGCAATCATTAATGGCACAGTCC
TCTGTGTTCATGGTGGGCTTTCACCTGATGTACGCACAGTTGATCAGATGCGGACAATTGATCGCAACTGCGAAATTCCTCATGAAGGACCTTTTTGTGA
TCTAATGTGGAGTGACCCAGAAGAGATAGAGACATGGGGTGTTAGTCCCCGTGGAGCAGGTTGGCTTTTTGGATCACGGGTGACAACCGAGTTTAACCAT
GTTAACAATCTTGAGTTAGTTTGTCGGGCTCATCAACTAGTCCAGGAAGGCCTAAAGTACATGTTCCCAGACAAGGGTCTTGTAACTGTGTGGTCTGCAC
CTAATTATTGTTACAGATGTGGGAATGTTGCTTCTATACTAAGCTTCAGCGAAACTATGGAAAGAGATGTCAAGATCTTCACAGAGACGGATGAGAACAA
CCAGATGCGAGGGCCGAGAAGTGCGGTCCCGTATTTCCTTTGACCTCCTTTGTACATTTTTTTTTGGCGATTTTCACTTTTGGTGCTCATTGTTGTAGCT
TCAGCT
page-top