Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig4968  (registered. 2007)
Contig Information
Length 1038 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_21379 [Oryza sativa Indica Group]
Score 1354
Evalue 1.50799e-147
Total Hit Count 57
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig4968
GGGCGACGTCGCCAACCTCAAGTGCCGGGTCCGGGCCGTCAAGAAGGCCGAGGTCGACAGCCCTGTCGCGATACAGACCATCAAAGGTTACCTCTTGGTG
GCCAGCCAGGACAAGATCATGGTGTACAACACCTCATCTCAGTACTATGGGAGGGTCGGGGCGCCCCGGCCGCTGTTCACCACTGCCATTAGGGACATCA
AGGCTGTGTTTGCGGGTTCTAGCGCCGTCATGTCAGCCGCACCAGCTGGGAAGCCTCTTATTGCCGCGGACCGTGAGAAGCTCGTCATCTTGGGGCTTGG
GGATGGTTACATCGCCATCTACCGTTCCAACTTCCCGGTGTACAAGCCGGAGAGCAATGCTGTTGTGTGGAGTGGCCCGGCGCTGCTTTTCCTCCTGTTC
TTGATTGGCATCTGGCAAGTCTATGTGAAGAAGAAGGATTCGTTGGGATGGACACCGGAGGAGACGTTTAACACCTCGGTCACAGCTCCTACAGGGAGCA
TCTTGAATCATCCAGCCAGTGAGCGAGCATTCGCAGATAGCACGACAAGAGCTGCTGATCGAAGCTATGTGGATGGCACGACCAGAGCCAGCGACAGAAG
CTATGTGGACGCCACTGCGAGATCTACTGACCGAGCCTATGCTGAGGCTACCAGGGCTGTGGACCTACGCGGCGGGGCGTTGAGAAGTGCTCCGAGAAGG
TATGTGTCCCCTACCAGGTATGCAGGGGCAGCCGGTATTCCGTATCGACCTGTTTCGGCCGAGCCCGGGCTTAGAGGAGCCACTCCAGAGCTGAAGTACC
GAGGCCCAGGTATGGAGCCCCCTGGTTTCCCCAAGAAAAGGGAGACATTGTTCTCGAACAACCAAGCCGTAGTAGATGATCACGTCGAATGAGGTCGCCG
GACTGTCGGTGCAGACAGCCGCCCCTAAATTTTGGTCTGGCTTGAAGTTCCCGCACCTAAGAGGGATATATGCCGCTGATCCACCCGCCTGTTGTTGTAA
GTTGTAAAACTCAGGAAATGTTTGTATGGTACGAATAC
page-top