Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig4966  (registered. 2007)
Contig Information
Length 727 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit major facilitator superfamily transporter [Acidovorax avenae subsp. citrulli AAC00-1] >gi|120591686|gb|ABM35126.1| major facilitator superfamily MFS_1 [Acidovorax avenae subsp. citrulli AAC00-1]
Score 82
Evalue 2.5746
Total Hit Count 7
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig4966
CCTCTTGCTCGCGCCGCCGCATCCTTGCTCCGGCGAACCCCACCACCAGCCACGCAGGGAGCTGCAACAGGAGGACAGGGGAGCTGTAACCGGACACTCC
GGGAGCTGCAACCAGCGGGCAGAGGAGCTACAAGCCGGGAACCAAACCGCCGACCATCGTGCTGGAAACAACACGCAGGGGTGCTGCAACCGGCAGATCA
AAGAGCTACAACTGCGGTTAGTTTTTGCTGGGACCGGTGAGAAATTTCGCTGCATCCATTGACGGTGAGCCTTTCTTTGCTGGAACCGGCTTTCTTTTTA
GCTGGAACCATGTTTTTGTTTTGCTGGAATCTTGTCATGCTTGCTAGTAGCTTGCAGCGAGAACACGCATCTGCTCGCCACGGACGACGATCTGCACGAT
CCACTCCGCTCGCAGGAGAGGGCAACCACCATCAGAAGATGCTGCAACCTCGGCGCGGCGGAGCTACAAGCGTAGGCCCGGAAGCTGCAACCAGCCAGAC
AAATAATGGAACCGGCAACGGCCGTGCTGCGACGGCGACGGCGGCGGTCGACCATTGCTGGAACCAGCTACTTTTTTTGCTGGAACCACCATTAAGTTTT
GCTGGAACAGCTTTTTTTGTTGCTACAATCAACTAGTGTGTTTTGCTGCTGAGTTTTTTTTTGCTGGAACCAGCATTTGTGATTGCTGGAACAGCCTTTT
TGTTTGCTACAATGGTCTCCTCAGATT
page-top