Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10002  (registered. 2012)
Contig Information
Length 1474 bp
Clones alternative view 162 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_dL Crown of seedling 8
Wh_h Spike at heading date 5
Wh_r Root 5
Wh_yd Spikelet at late flowering 8
Wh_CSEC Callus 9
Wh_DPA20 Seed DPA20 4
Wh_EM Dormant seed with water absorption 6
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 3
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_OKCS Seed DPA5 7
Wh_SHC Shoot grown with cold treatment 1
Wh_V483 Shoot grown under cold condition for 3days 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 4
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 6
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_SP 7
WH_XA Root 20
WH_XB Root 19
WH_XC Root, treated at 50 microM Al for 6h 10
WH_XD Root, treated at 50 microM Al for 6h 9
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|9652119|gb|AAF91407.1|AF271362_1|AF271362_1 nucleoside diphosphate kinase [Lolium perenne]
Score 293
Evalue 4.00E-77
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10002
TTTTTTTTTTAATGGAGAATGCTCTTACTCGCTTCCATTTATTACCGTCGCTGCCATCCATTGCCACGCTTCAGGGAGTTCCCCAGAGTCATGTCTTTAC
ATATTGCCTTTAACATCTACAATGCCAATGCTGTTAACGATGTTAATAGTTTTCGCTAACACACTTCTATAACATTGAGTGTGCATCAACAAAATTAAGC
ACACCAATTTGCTGTAAAGATCATGGCAAAGCCACAACCAAAACATGAAATGCAACTCAATACCATATAGTAAATATAGAGCAGCAGATACCGCTTGCAT
GCTCAAGCACAAGGAGATAACTTCAGTTCACACAAACAAGGTTCCCGAGATACAAATCTCAAAACTGTAAACAACCAAAGACTAGTTTGGTAGATGCTTT
GCGAAACCTGCACTCAACCACTCATGACACATCTTAGGCCTCGTAGATCCAGTTGTGCTGGCTGCTCCTCCACTCGGCAATGCCCTCAGGGAACCACAGG
GCGATCTCCTTCCTGGCACTCTCAACTGAGTCGCTTCCATGGATGACGTTCCTGCCGATGTCGACGGCGAAGTCACCACGGATGGTGCCGGGCTCAGAGG
CCAGGGGGTTGGTGGCGCCAATGATCTTGCGTCCAGTGGAGACGACGCTCTTGCCCTCCCAGACCATAGCGACGACCGGGCCGGAGACGATGTACTCCAC
GAGCCCAGCGAAGAAGGGCTTGGAGGACAGATCGGCGTAGTGCTGCTCGGCGAACGACTTCTCCACGTTCTGGAGCTTCAAACCTTTGAGGTAGAAGCCC
TTCTTCTCGAAGCGGCTGATGACCTCGCCGATGAGGCCCCTCTGGACGCCGTCGGGCTTGATCATGATGAAGGTCTGCTCCGCCATTGTTTTGCTTCTGT
GCTAAGCTTGAGATTTCTGATTGGGTTTGGACTGCGACCTCCTCCCGAANNNNTTTGCTGCCCCCCTCCACACCCGTGCCGCCGCCGCCGTCGCCGCCCG
CGTCCCCCCATGGCGCTGCCGAACCAGAACACCGTCGATTACCCCAGCTTCAAGCTCGTCATCGTCGGCGATGGCGGGACTGGCAAAACCACTTTTGTGA
AGAGGCATCTCACTGGAGAGTTTGAGAAGAAATACGAGCTTGCGGCTGCAGCGGCACAGCCACTGCCCGACGACGATGACGATCTGATCGAGTAGAGAGA
GGATGATGAGTCTGTCTGTCTTATCAATCAATACTTTGAGAGCCAGAGACTGTGCGAGTCGGTTTTAGGTTGAAGGCTTGATTTGGAGTAGTCAAGCCGG
ATGTTTTTCCTGTCTGCCTTGCCTTGTCTGGTGGGCTGCAAACTGTTTGTGTGACATTGATCTACATGATGTTGCTTGCCATGGATTTGTTGTTGGCCAC
CTTGATGGTTCATCAGTATTATTATGCCTGTTGGCTCAAAAAAAAAAATCATATATTTATCTTGAAAAAAAAAA
page-top