Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

MUGEST2003_all.Contig23574  (registered. 2003)
Contig Information
Length 921 bp
Clones 18 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_OKCS Seed DPA5 4
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 4
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit Os12g0236400 [Oryza sativa (japonica cultivar-group)] >gi|585337|sp|Q08479|KAD1_ORYSJ RecName: Full=Adenylate kinase A; Short=AK A; AltName: Full=ATP-AMP transphosphorylase A >gi|391877|dbj|BAA01180.1| adenylate kinase-a [Oryza sativa] >gi|77554109|gb|ABA96905.1| Adenylate kinase A, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113648969|dbj|BAF29481.1| Os12g0236400 [Oryza sativa (japonica cultivar-group)] >gi|125536202|gb|EAY82690.1| hypothetical protein OsI_37905 [Oryza sativa Indica Group] >gi|125578925|gb|EAZ20071.1| hypothetical protein OsJ_034280 [Oryza sativa (japonica cultivar-group)] >gi|215697656|dbj|BAG91650.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765406|dbj|BAG87103.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1161
Evalue 3.02051e-125
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23574
CGAGCTAGCAAAAGCTGTAATGAAATTGTGCAATAGTGCACATGCAGACAGAAAATGAGAAACATAGGATGCCGGTATGAGTTTAAAACTTGTAAGAAAC
CCAGCCGGGGTTTTGTTACATGTCACTTTCAAGGTGAAACAGGCCCTTCACGAAAGAGCTTTCTGCAGCTCGGCGGTCACTTCCTTTGGTGGTTTCTCCG
CATGAAGATTTGCCACTAAGCCATTCTTGGAGTAGTAGTCAATCACAGGTTCAGTTTGTATGTGGAAAGCTTCAAGCCTTGACTTCAAGACCTCAGCTGT
GTCATCTTTTCTTTGAATTAAGGGTTCTCCCGAAACATCATCAACTCCCGGAGTCTTGGGAGGAGCAAATTTTGTATGGTAAGATCTACCACTCGATGGG
TGTATCCAACGGCCAGTAATTCGTTCTTCCAATATTGCATCATCAATTGCAAAATTTAGAACCTTGTCAACCTTAGCACCTTGCTTTGCGAGCATTTCAT
CGAGCTTTTGTGCTTGAACAACAGTTCTAGGGAAGCCATCAAGGATAAAACCTTTTTGACATGAAGGTTTTTTCATGGCTTCATCAATAATCCCAACAAC
CAAGTCATCTGAAACAAGCTCTCCCTTGTCCATAGCTTCTTTAGCCTTGATACCCAGAGGAGTCTTAGCGGCGACAGCAGCCCTCAGCATATCGCCAGTG
GCTAAATGGCACAAACAATATTCATCCTTAATAAGGGGAGACTGTGTTCCCTTTCCAGAGCCAGGTGGACCGACGAGGATGATGCGCTTGTCGGGCTTGG
AGCTGCACTTGGCGCGACGGAGCAGCTCGGTCATGAGCTCCACCGAAGGCACGTCCTCGATGTTCGTCGCCATCTCTTCCTCCGCCGGCCGCAACAACGG
GAACGACTCGACTCGCGTGCC
page-top