Home About update informationSite map Contact Us
Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig30800  (registered. 2012)
Contig Information
Length 830 bp
Clones alternative view 567 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 39
Wh_dL Crown of seedling 13
Wh_e Seed DPA10 11
Wh_f Spike at flowering date 11
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 2
Wh_r Root 21
Wh_yd Spikelet at late flowering 11
Wh_SH - 2
Wh_CSEC Callus 35
Wh_DPA20 Seed DPA20 28
Wh_EM Dormant seed with water absorption 13
Wh_EMI Dormant seed with water absorption after breaking 7
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 10
Wh_KMP Shoot grown under continuous light 6
Wh_KMV Shoot grown with continuous light after cold treatment 10
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_OKCS Seed DPA5 6
Wh_PCDAM Anther at meiosis 4
Wh_RDr Root of dessiccated seed 8
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 2
Wh_VSCB Liquid cultured tissue 11
Wh_VWD Shoot grown with dessication 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 3
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 4
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 15
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 13
WH_XN Leaves, plant was grown at constant 23Ž 7
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 17
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 12
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 4
WH_XR Roots, 18 day old plants were grown hydroponically 10
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 6
WH_XT Roots, 18 day old plants were grown hydroponically 18
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 20
WH_SP 9
WH_XA Root 23
WH_XB Root 17
WH_XC Root, treated at 50 microM Al for 6h 22
WH_XD Root, treated at 50 microM Al for 6h 15
WH_XE Seedling, infected with leaf rust 10
WH_XF Seedling, infected with leaf rust 5
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 26
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 29
WH_XV Leaves, plant was grown at constant 23Ž 10
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 3
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 3
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|75246527|sp|Q8LRM8.1|TCTP_WHEAT|TCTP_WHEAT RecName: Full=Translationally-controlled tumor protein homolog;
Score 343
Evalue 1.00E-92
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig30800 
TTTTTTTTTTAACAGGGCAAAATCGCTTGATTCTAGCGAGTAAAAGTTTTTTTTTTGACCAAAACATAACCACACCAATTTCACGATTACCATTACAAAG
CAAATCCCACAATTATCAGAAAGTTTTCAAGACACTCAACATCTGATAGTTACCGACACAACATTGGAGAGTCGACTGACAACCATAGAGCAGAGCAAAA
ATACTGACGACCGCATAGATTTTAGCATACAGTGCGATTAGCACTTGACCTCTTTCAGCCCATGTGCAAAGTACAGGAAAGTTGGATCAGCAGCTCCCTC
CTTGTAGTAGGCGAACACCACGCCGCCATCATCATGCATGCTCTCGCCAACAAAGAACTGAAGGTCCTTGAGCTTGCTAAGAAGATACTTTGTGGCAGAC
TCAACATTCTTCTTGAAAACATCTAGGTCATCCCCTTCAAGCTTGGCAGAGAGGTTCTTGATGTAGCGCTTCATGTGAGAGATAAACTGCTTCTTGTCAA
AAGCAGGTTGCTCCTGAAGACGGAAGGTGTCAACAATGTCAACCACCTTCACGGCCTGGTCATCGACACCCTCATCATCACCACCACCCTCAGCAGAGGG
ATTGGCTCCAATGTCCACATCAACTGCTCCTTGAACGACCCAATGGCCGTCGACTTCCCAGAGCACGCCGTTCTCCAGCTCCCTGTACGGGAACGAATCC
GACAGAAGCTCGTCGCCGGAAAGCTTGTCCTGGTACACGAGCATGGTGCCGCCTCTTGAGATTTCTCCCCCGAAAAAGGAGAAAACCCTAACGAGCTCTG
GGGGAGGCAGGGGAGTAGCGGCCCTCGTGC
page-top