Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig2021
Contig Information
Length 1186 bp
Tissue Dormant seed with water absorption after breaking
Clones 8 Clones [Download: CSV  ,  FASTA ]
whei5i23    whei6m17    whei11b14    whei14i09    rwhei5i23    rwhei6m17    rwhei11b14    rwhei14i09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit S-adenosyl-L-homocysteine hydrolase [Hordeum vulgare subsp. vulgare]
Score 1680
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig2021
ATATATGCCATTATTTCTGGGCAAAGCAAACGCCGCCTCTCCCAACCCTCACAAGGGCTCAAAACATAACCATAATAACAAATCCTCCGCCTAAGAGACA
GCATGTAAGATAATAGAAGGGAAACAGGATAGTTGATAAGAGTTCCCGTTGGTGCCGCTGCTCCGACTCAGGCTCAGGCCAGCCGCTAGTCGTGCTGGAC
ACACTAGTACCGGTAGGCCGCAGGCTTGTACGGACCCTCAACTGGGATGCTAATGTAGTCAGACTGGGACTTGGTGAGCTTGGTCAGCCTGGCGCCGAGC
TTGCCCAAGTGGAGGGCCGCGACCTTCTCGTCGAGGTGCTTGGGGAGAACGTACACCTTCTTCTCGTACTTGCCAGTGGCCTTCTCGTTCCACAACTCAA
GCTGAGCAATAACCTGGTTGGTGAATGAGCAGGACATGACGAAGCTGGGGTGGCCAGTGGCACATCCAAGGTTCATCAGACGACCCTCAGCAAGAACAAT
GATGCCAGTCTTGGTCTCGGGGAAGACCCAGCGGTCAGTCTGGGGCTTGATGGTGATGCGCTTGACACCAGGGTAGGTCTCAAGGCCGTTCATATCGATC
TCATTGTCGAAGTGACCAATGTTGCAGACCATGGCGTTGTTCTTCATCTTCCTCATGTGGTCAACCATGATGATGTCCTTGTTTCCGGTGGTGGTCACAA
AGATATCAGCCTCAGAGACAACATCCTCCAAGGTGAGGATCTGGATGCCCTCCATCAGGGCCTGAAGGGCACAGATGGGGTCAATCTCTGTCACGATCAC
ACGGGCACCAGCCTGCTTGAGTGCGGCCGCACAGCCCTTGCCAACATCACCGTAACCGCAGACCACGGCGACCTTGCCGGCGATCATAACATCAGTGGCC
CTCATAAGACCATCAGGGAGCGAGTGACGGCAACCGTAAAGGTTGTCAAACTTGCTCTTGGTGACGGAGTCGTTGACGTTGATGGCGGGGAAGAGGAGGG
TGCCGGACTCCTGCATCTGGTAGAGCCTCTTGACGCCGGTGGTGGTCTCCTCGGAGACACCGACGAGCCTCTCCTTCATCTTGCGGTACTTGCTGGCGTC
GGTCTTGAGCCCGTCGCGGATGATGGTGAGGACGATCTTGAACTCGGGGTTGTCGGTGGACTCCGGGTCGGGAACCTTGCCGGATT
page-top