Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig2314
Contig Information
Length 1130 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 9 Clones [Download: CSV  ,  FASTA ]
whgc11h13    whgc1g02    whgc2h10    whgc5m18    whgc6l16    rwhgc1g02    rwhgc5i22    rwhgc5m18    rwhgc6l16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit mitogaligin [Homo sapiens]
Score 92
Evalue 0.373099
Total Hit Count 4
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig2314
CCGCCCCTGTATAAAATCCCCCAGCACACACAGCCACAGCAACCCAATATACACGGAGAAGAGATCGTCATCATCCGCCAAACCAGATCGGCTCGGCTGC
TTCCTCTTCTTCAACTTCGCAGAATCGCTGGTCTTCTCGTCCTCTAGTTAAGTCCCTCGACAGCAATGGGAGGAGGCAACGACGGTCATGGGTACCCACC
CGGTGGCCAGGGGGGATACCCTCCGCAAGGGTACCCGCCGCAGCAGGGAGGTTACCCTCCACAGCAAGGATACCCGCCTGCACCTGGAGCTTACCCACCT
GCACCTGGGGCATACCCTCCTGCACCTGGGGCATACCCTCCTGCGCCCGGAGCGGGTGGCAGTGACGGGGAGAAGGGGCTCCTCTCCAACATCATGCACG
GTGTTGCCGGTGCTCATGGTGGTGGCCATGGCTACCCATCTGGTGGCCACGGGTACCCCCCGCAGCAGCATGGATACCCTCAGCAAGGCTACCCTCCTCA
GCATGGCTACCCACCGCAACAGCATGGCTACCCTCCACAGCAGCATGGCTATCCCCCTGCTGGCTACCCTGGCTCATCTGGTCACAGTGGTAGCCATGGA
GGAGGAGGCATGGGCATGGGCGGCATGCTAGCTGGAGGCGCAGCAGCTGCTGCCGCCGCTTACGGAGCACACAAGATTTCTCACGGCGGCCACGGTGGAG
GTGGACACATGATGGGAGGCATGATGGGCGGCCATGGAGGCTATGGCGGCGGGTACGGCCACCACGGCGGCAAGTTCAAGCACGGGAAGCACGGCCACGG
CAAGTTCAAGCACGGCAAGCATGGGAAGCACGGCATGTTCGGCGGCGGCGGAAAGTTCAAGAAGTGGAAGTAATGCGCTAGCTAGTAGCTTCACCATGGC
TGATGAATCAAAAAAATACCTAAACTCTTCGTGTAGGCTTCCAGAACTTGGTTTGGTCAGGGAAAGCCTTTGAGATGTATCTAAGCAGGGTGTGGTGTGG
TTGCTGCCCGGATCTCGTGGAGCTTCCATCCTTTCCTCTATATGATTTGGCACTCTAGTCTGCGTCTGTGACAAGATATGACTTGCTAATAAGTACCTGA
ATTCTGTCTGGTGCTATGCTTTACCGCTGT
page-top