Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20189  (registered. 2007)
Contig Information
Length 1421 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_PCDAM Anther at meiosis 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_027692 [Oryza sativa (japonica cultivar-group)]
Score 1469
Evalue 1.09821e-160
Total Hit Count 445
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20189
GCTCGCCACACACACCGACACAGCACACAGCCACACACGCGCGTAGCATTGCGGGCTTTGCACAAGCCCGGAGCCGGAGGCAAGGGTGGACGCTGCCGCG
CGTCCTGACCTCCCCCCGCGAATAATCTGGTCTCATGGCGAAGCAACACTATGCAACCAGCAGCCTTGTGATAGGCTATGCCTTGTGCTCGAGCTTGCTG
GCGATCATTAACAAGTATGCCGTCACAAAGTTCAATTACCCCGGCCTCCTGACAACGCTACAGTACTTGACATCTGCTGCTGGTGTTTGGGCCCTTGGAA
AGCTAGGCTTTCTCTGCCATGACCCCTTCAACCTGGAGACTGCCAAGAAATTTGCACCTGCTGCTATTGTCTTCTACCTCGCCATATTTACAAACACAAA
CCTCCTTGTTCATGCCAATGTGGACACGTTCATAGTTTTCAGATCCTTGACTCCGCTTTTGGTTGCTATTGCTGACACAACCTTCCGGAAGCAACCATGC
CCTTCCAAGCTCACATTTTCATCCCTTGTTATCATATTGGGAGGAGCGGTTGGCTATGTGATAACAGATTCTGCATTCAGCCTCACAGCATACTCTTGGG
CGCTTGCCTATCTGGTGACAATAACAGCTGAGATGGTGTACATCAAGCATATTGTGACGAATCTGGGTCTAAACACATGGGGTTTTGTGCTGTATAACAA
CCTTCTTTCCTTGATGATATCCCCCATCTTTTGGTTTTTGACAGGGGAGCACAAGTCGGTCTTCTCAGCAGTCGAATCACGGGTTGAGGGTTGGTTCCAG
CTCGATGCCTTTGTCGCGGTGGCATTGTCATGCTTGTTTGGGTTACTCATCAGCTTCTTTGGCTTTGCGGCTAGGAAAGCAATCTCAGCCACGGCATTCA
CGGTGACTGGGGTTGTGAACAAGTTCCTCACGGTGGCAATCAATGTGACGATCTGGGACAAGCACGCCAGTGCATTTGGTTTGGTTAGCCTGCTGTTCAC
TCTTGCTGGTGGAGTACTCTATCAGCAATCAGTTACTGCAAAAGGAAATATTGCATCAGCTCAGCATGAAACGGCATCGGAGGAACTTAAGGATGAAAGT
GACAGTGCTGAGTATGATGAGGAGAAACAGAAGCTTATTTCATCTTGAGTGCCCAGTGCATGAAGAGTGCCATTCTTAGCTTTAGGTCGATAGGTTTGTC
CTTTAATTTTGCTTAATAGGCCCTTTGCAACAGAACCATACAATAGGCAGTGCCAGTGTTAGTACACAATATTTCCTTTATAACTAGAAGGCCCTTTCTG
TCTGTGTTACTCATTTCTACTGGAAAAAAACTAGATTAAATTACTGTTTTTATGGTAGGAGTGATGCCCGTTGTAAACTTGTAATACAATACCTATATGG
ATATCTCATATTATTCTGATA
page-top