Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig1924
Contig Information
Length 774 bp
Tissue Shoot grown with dessication
Clones 5 Clones [Download: CSV  ,  FASTA ]
whsd5d03    whsd8h24    whsd16a05    whsd16c08    whsd16i08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Phosphoglycerate kinase, cytosolic >gi|21835|emb|CAA33302.1| unnamed protein product [Triticum aestivum]
Score 1153
Evalue 1.88005e-124
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig1924
CAAGCCAGCCCATCGCCACTCCAATCCAGCGACCACCTCGCCCAGATCGCCGCCGATTCGATCCGGTTCCTCGACGGGATGGCGACCAAGAGGAGCGTGG
GCACCCTCGGGGAGGCGGATCTCAAGGGGAAGAAGGTGTTCGTGCGCGCCGACCTCAACGTGCCGCTCGACGACGCCCAGAAGATCACCGACGACACCCG
CATCCGCGCCTCCATCCCCACCATCAAGTACCTCCTCGAGAAGGGCGCCAAGGTCATCCTGGCCAGCCATCTGGGCCGCCCAAAAGGTGTCACCCCCAAG
TTCAGCTTGAAGCCTCTTGTTGCACGCTTGTCTGAGCTCCTTGGACTTGAAGTTGTGATGGCCCCTGACTGCATCGGTGAAGAAGTTGAGAAATTGGCTG
CTGCTTTGCCAGATGGTGGTGTTCTACTCCTAGAGAATGTTAGATTCTACAAGGAGGAAGAGAAGAACGATCCTGAGTTTGCTAAGAAGCTTGCGTCAGT
TGCTGACCTTTATGTAAATGACGCTTTCGGCACTGCACATAGGGCTCATGCTTCAACTGAGGGTGTAACCAAGTTTTTGAGGCCTTCTGTTGCTGGCTTC
CTCATGCAGAAGGAACTTGACTATCTTGTCGGAGCTGTTGCCAACCCAAAGAAGCCATTTGCTGCCATTGTTGGTGGATCAAAGGTCTCATCTAAGATTG
GTGTGATCGAGTCTCTGCTGGCCAAGGTTGATATCCTCATCCTTGGTGGTGGTATGATCTTCACATTCTACAAG
page-top