Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig1777
Contig Information
Length 685 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 4 Clones [Download: CSV  ,  FASTA ]
whec11g16    whec5d03    whec6d16    whec17g15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein L3 [Triticum aestivum] >gi|34105770|gb|AAQ62076.1| ribosomal protein L3 [Triticum aestivum] >gi|34105774|gb|AAQ62078.1| ribosomal protein L3 [Triticum aestivum] >gi|118152389|gb|ABK63938.1| ribosomal protein L3-B3 [Triticum aestivum] >gi|118152400|gb|ABK63944.1| ribosomal protein L3-B1 [Triticum aestivum] >gi|146141392|tpg|DAA01144.1| TPA_inf: ribosomal protein L3B-3 [Triticum aestivum] >gi|146141396|tpg|DAA01146.1| TPA_inf: ribosomal protein L3B-1 [Triticum aestivum]
Score 1061
Evalue 6.87238e-114
Total Hit Count 408
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig1777
CCATCCGCCGCCGCCTCCACCTCTACAGGGGAAGGAAGGGAAGATGTCGCACCGTAAGTTCGAGCACCCGAGGCACGGATCCCTCGGTTTCCTCCCCAGG
AAGCGGTGCTCGCGCCACCGCGGAAAGGTGAAGGCCTTCCCCAGAGATGACCAATCCAAGAAATGCCATCTCACTGCCTTCCTTGGCTACAAGGCTGGGA
TGACTCACATTGTGCGTGAGGTCGAGAAGCCTGGTTCCAAGCTACACAAGAAGGAGACATGTGAGGCTGTCACCATTGTTGAGACACCCCCGATTGTTAT
TGTTGGACTTGTTGCCTATGTGAAGACTCCTCGTGGCCTTCGTACTCTCAACTCTGTCTGGGCACAGCATCTCAGCGAAGATGTGAGGAGAAGGTTCTAC
AAGAACTGGTGCAAGAGCAAGAAGAAGGCCTTCACCAAGTATGCTCTGAAGTATGACAGTGATGCTGGCAAGAAAGAAATCCAGATGCAGCTTGAGAAGA
TGAAGAAGTATGCTACTGTTGTCCGAGTTATCGCCCATACCCAGATCAGGAAGATGAAGGGGTTGAAGCAGAAGAAGGCTCACCTCATGGAGATCCAGAT
CAATGGTGGCACCATCGCTGACAAGGTCGACTATGGTTACAACTTCTTTGAGAAGGAAGTCCCCATTGATGCTGTATTCCAAAAA
page-top