Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig699
Contig Information
Length 978 bp
Tissue Anther at meiosis
Clones 2 Clones [Download: CSV  ,  FASTA ]
whpc16c15    rwhpc16c15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0869800 [Oryza sativa (japonica cultivar-group)] >gi|15408693|dbj|BAB64099.1| putative photosystem II subunit PsbS [Oryza sativa Japonica Group] >gi|20160872|dbj|BAB89811.1| putative photosystem II subunit PsbS [Oryza sativa Japonica Group] >gi|113534460|dbj|BAF06843.1| Os01g0869800 [Oryza sativa (japonica cultivar-group)] >gi|125528521|gb|EAY76635.1| hypothetical protein OsI_04589 [Oryza sativa Indica Group] >gi|125572786|gb|EAZ14301.1| hypothetical protein OsJ_004126 [Oryza sativa (japonica cultivar-group)] >gi|215701291|dbj|BAG92715.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737433|dbj|BAG96563.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215764949|dbj|BAG86646.1| unnamed protein product [Oryza sativa Japonica Group]
Score 833
Evalue 3.58732e-87
Total Hit Count 248
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig699
GAGCGATATCATCACGAGTGAGCGTCTAGGCGGGCATCCATGGCACAGTCGATGCTCATGTCCGGCGTCAACGGCGTGGCCTCCGGCAGGAGCCTGCTGC
AGGCGGCCCGGCCGTCGTCAGCGTCCACGCCCTTCTCGCGGCTCGCGCTCTCCTCCTCCTCGTCGGCGGCAGCGTACTACAAGCACATGCCGTCCCTCTC
CGTCCGGACCATGGCCCTGTTCGGCAAGAAGACCAAGGCCGCGCCGGCCAAGAAGGTCGTTGCCCCCAAGCCCAAGACCGAGGACGGTATCTTCGGCACG
TCCGGCGGGATCGGTTTCACCAAGGAGAACGAGCTCTTCGTCGGCCGTGTTGCCATGATTGGCTTCGCCGCATCGATCTTGGGAGAGGCCATCACCGGCA
AGGGCATCCTGTCCCAGCTGAACCTTGAGACCGGCATCCCGATCTACGAGGCGGAGCCCCTCCTCCTCTTCTTCATCCTCTTTACCCTCCTCGGTGCCAT
CGGCGCGCTCGGAGACCGCGGCAGGTTCGTCGACGAGCAGCCCACCACCGGCCTCGACAAGGCCGTCATCGCCCCCGGCAAAGGCTTCCGCTCCGCCCTC
GGTCTCAGCGAGGGAGGGCCGCTGTTCGGGTTCACCAAGTCGAACGAGCTGTTCGTGGGGCGGCTGGCGCAGCTGGGGATCGCCTTCTCCATCATCGGGG
AGATCATCACGGGCAAGGGCGCGCTGGCGCAGCTCAACATCGAGACCGGGGTGCCCATCAGCGAGATCGAGCCGCTCGTGCTCTTCAACGTCGTCTTCTT
CTTCATCGCCGCCATCAACCCCGGCACCGGCAAGTTCATCAGCGGCGAGGAGGACGACTAGATCACGCGCGAATGCTTTTTGGCCATTAATTGTACGTCC
GTCCGTCCGTGCTTTGCTTGTTTGTTGTGTACGTGAGACCTTGGGGTGTACTTAGGTGTAAGAAGTTGGTCGTTGCCT
page-top