Home About update informationSite map Contact Us
Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig29819  (registered. 2012)
Contig Information
Length 630 bp
Clones alternative view 658 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 1
Wh_r Root 1
Wh_SH - 3
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 3
Wh_KMP Shoot grown under continuous light 12
Wh_KMV Shoot grown with continuous light after cold treatment 8
Wh_OKCS Seed DPA5 4
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 8
Wh_V4816 Shoot grown under cold condition for 16days 12
Wh_V483 Shoot grown under cold condition for 3days 12
Wh_VABA Shoot with ABA treatment 4
Wh_VWD Shoot grown with dessication 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 8
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 4
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 6
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 17
WH_XN Leaves, plant was grown at constant 23Ž 12
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 6
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 24
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 12
WH_XR Roots, 18 day old plants were grown hydroponically 68
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 112
WH_XT Roots, 18 day old plants were grown hydroponically 127
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 98
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XE Seedling, infected with leaf rust 28
WH_XF Seedling, infected with leaf rust 11
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 23
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 7
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 4
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|1171037|sp|P43400.1|MT1_WHEAT|MT1_WHEAT RecName: Full=Metallothionein-like protein 1; Short=MT-1
Score 169
Evalue 3.00E-40
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig29819 
TTTTTTTTTTTTTTTTTGAATTTTTGTTTTAGGATTAGTTAATTAGGTAAATCTTTCATTCTTACATATTCATCACTCCATCCATAGTGGAGATAGATGA
AGCAATTACAGGGAGACATGCGCACACACATACACACAAGGACACCATGGGCAGAGCATAGGCGGAGAGCGAGCAAGCAAATCACACGCACACGCACCCT
TGCTCGACTCCATCAGATCAGACGCTCGTTATTCAAGTATACTCTCACACCATCACACGTACGTACGTACGAGTGCATGCAGCTTAACAGTTGCAGGGGT
TGCACTTGCAGTTGTCGCCGCAGCTGCAGCCCTCGCCGGACTGCCCGGCGGCCACCTCGAACTGCCCCGCCTTGTTCTCAGGAGCCACGCCGAGCACGAC
CACGGCGGCGACCTGGGCGGCGGCGCTGCCCTGCTCTGTCAGATCAGGGTACATCTTCCCGCACTTGCAGTCTGAGCCGCAGCTGCAACCGGATCCACAG
TTGCAAGACATCCTCCAAATCTGTGAACCCAAAAAGATTTCAAGGAGAAGAAGATGGGCTTTGGTATCGGGGATGATGATGAGCACAATTGAATTGAATG
GATAGCCTCCCACCGGCGCCACTATCCCGG
page-top