Home About update informationSite map Contact Us
Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig24198  (registered. 2012)
Contig Information
Length 604 bp
Clones alternative view 301 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 3
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 2
Wh_yd Spikelet at late flowering 1
Wh_SH - 3
Wh_CSEC Callus 9
Wh_DPA20 Seed DPA20 4
Wh_EM Dormant seed with water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 9
Wh_KMP Shoot grown under continuous light 3
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 14
Wh_PCDAM Anther at meiosis 18
Wh_RDr Root of dessiccated seed 6
Wh_SHC Shoot grown with cold treatment 15
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 4
Wh_V483 Shoot grown under cold condition for 3days 5
Wh_VHS Shoot with heat shock treatment 3
Wh_VSCB Liquid cultured tissue 10
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 8
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 6
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 4
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23Ž 20
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 13
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 10
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 28
WH_XT Roots, 18 day old plants were grown hydroponically 3
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 7
WH_SP 1
WH_XA Root 2
WH_XB Root 6
WH_XC Root, treated at 50 microM Al for 6h 16
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XE Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 5
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 23
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 4
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|195612358|gb|ACG28009.1|| hypothetical protein [Zea mays]
Score 150
Evalue 9.00E-35
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig24198 
TTTTTTTTTTTTAAAAAAGATGAATTTTGCGACAGTTTTTTGACTAAGCACGAGGAGCAAATCCACAGAGGATTAAGATAATGTAGCACAACAGGCTGAT
AGAGGACGATTACATAGTAGATGGGCACACAACCAAAGCAGCCGGGACAGCAGCACACCGAGTTCAGACCCCAAGCTTAGGTCAACAATCAGTCATTGCG
GAACATGATAATAGTAGGTGGATTATGACAGCTTCTCTCTCTCTCTCTCTTTTATCTCTCTCTCTGTCTGATTGGGCAGATATCACTGCTTGAGGTGAGG
GAAGCACTGGACGAGCTCGCTCTTCGGATGCTTTGCCTCGGCATGCTCCTTGCACTTTGCTTCAGAGGTGGTGCAGATGAAAGTCTGCATGCATATCTTG
CACTGGATGTTCATGGCCTTCTTGTTGGCCTCGAGCTGGCTCCCCTTGCCGCCCTTCAGCTTCTCGAGGTTCCTCTCCCTCGCCATCTTGGACTTCTGCG
CGTTGCCGCCGCCCATGGCTGTTGATTCCTCGACGAGACGAGACGAGACGATGCTTTTTCTGCTTCGGCGGAAATTTGGTGGGGAAGGCGAGAAGCAGGA
GGCG
page-top