Home About update informationSite map Contact Us
Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32703  (registered. 2012)
Contig Information
Length 510 bp
Clones alternative view 174 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 1
Wh_r Root 3
Wh_DPA20 Seed DPA20 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_KMP Shoot grown under continuous light 7
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_SHC Shoot grown with cold treatment 3
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VWD Shoot grown with dessication 6
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 18
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 3
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 7
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23Ž 23
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 14
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 5
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 7
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 7
WH_XF Seedling, infected with leaf rust 7
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 8
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23Ž 6
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 6
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 7
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|23954355|emb|CAD54079.1|| metallothioneine type2 [Hordeum vulgare subsp. vulgare]
Score 179
Evalue 1.00E-43
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32703 
CCGGGGAAGCACACAAGAAGCTCATAGCCATTCAAAGCCTCTCCATCTCCGAAGCTCCAACCCAACCTCGAAGATGTCTTGCTGCGGAGGAAACTGCGGC
TGCGGCACCGCCTGCAAGTGCGGCAACGGCTGCGGCGGCTGCAACATGTACCCCGAGGTTGAGGCCGCCGGCGCCACCCTCCTCGTCTCCGCCACCGCCA
CCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCGGCCGAGAACGGCGGCTGCGGCTGCACCCAGTGCAAGTGCGGCACCAGCTGCGGCTGCTCCTGCTG
CAGCTGCTAGATCCATCATCGATCATGCATGCACCGTGCCGTGCGTGCATCATCGATCGTATCGATCTACTACTACCATACCATGTAACCGCAACCTGAT
CGAGGGCCTTTATGTACGCACCTGACCTGCATCAGCAGTCAGGTGCCATGCCATGATTGTAAACAGGCCCCCCTAAATAAAACCTCCCTTGATTAACTAA
AAAAAAAAAA
page-top