Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig5757  (registered. 2003)
Contig Information
Length 828 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Homology (BLAST) Top Hit hypothetical protein OsJ_012858 [Oryza sativa (japonica cultivar-group)]
Score 704
Evalue 2.44659e-72
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig5757
TGGGTGGCCATCGCCGGTGAGGAAGAGGCCGAGAGGATCATCGACGGCGCCTTCTTTTTTTGTGTGCGCTGGCTCGGATGACGTGGCCAACACCTACTTC
ACCACCCCGTTCCGAATCCTGGAGTACGACATCCCGTCCTACGTGGACCTCCTCCTCGCCGGCGTGGACAAGTTCCTCCGAAGCATTATTGCTCGCGGAG
CAAAGCTTATCGGTTTCGTGGGCCTTCCACCTATCGGGTGTGTGCCTTCGCAGCGAACGGTTGGCGGCGGGTTGCACCGTCGTTGCGAGCCCAAACGAAA
CTACGCGGCACAACTCTACAACTCGAGGGTGCAGGTGCTCATCAACGGGTTGAACGCGGAGCCTGGGTTCAACACCCGTGTTGTCTACTTGGGGATCTAT
GACATCATCCAAGAGCTCGCCGAGGGCGGGGAGCGGTGGGGGTTCACGGAGACGACCCGCGGGTGTTGTGGGACTGGGCTCATTGAGGTGACGAATCTCT
GCGACTCGAGGTTCATGGCGGTGTGCCAAGACGTATCCAAGCATGTCTTCTTCGACAGCTTCCATCCCACGCAAAGGGCGTACAAGATCATTGTTGATAA
CATCTGGGACAACTACGGCCACCTCTTGCAACCCTAAATGGAGGTTTTGACATCTATTGGGCGCCATGGATCGATAAACAAAGAAATTGAAAATGACATA
TATACTTGTGAGAGATTTTCTTTTACTATTCGAGATCCACTTATGCACATGCAAGCAATCAAGCCGGTTCCCAAAAGATGGAGAAATATAGGAAAAATGT
TCTCTACTGCCTCGATCGAGTATACATT
page-top