Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig1867
Contig Information
Length 1030 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 3 Clones [Download: CSV  ,  FASTA ]
whms16i04    whms16l13    rwhms16i04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit proteophosphoglycan ppg1 [Leishmania braziliensis MHOM/BR/75/M2904] >gi|134060469|emb|CAM37639.1| proteophosphoglycan ppg1 [Leishmania braziliensis]
Score 88
Evalue 0.944742
Total Hit Count 13
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig1867
CGTCGTCATCCGCCAAACCAGATCGGCTTCTTCTTCTTCTTCTTCTTCTTCAACTTCGCAGAATCGTCGGCGGTCGTCTCTTCCTCTAGTTAGATCCTTC
GAGAGCAATGGGAGGAGGCAATGATGGTCATGGGTACCCACCCGGTGGCCAGGGGGGATACCCTCCGGCAGGGTACCCGCCGCAGCAGGGAGGTTACCCT
CCACAGCAAGGAGGTTACCCTCCACAGCAAGGATACCCGCCTGCACCTGGAGCTTACCCACCTGCACCTGGGGCATACCCTCCTGCACCTGGGGCATACC
CTCCTGCGCCCGGAGCGGGTGGCAGTGACGGGGAGAAGGGGCTCCTCTCCAACATCATGCACGGTGTTGCCGGTGCTCATGGTGGTGGCCATGGCTACCC
ATCTGGTGGCCACGGGTACCCCCCGCAGCAGCATGGATACCCTCAGCAAGGCTACCCTCCTCAGCATGGCTACCCACCGCAACAGCATGGCTACCCTCCA
CAGCAGCATGGCTATCCCCCTGCTGGCTACCCTGGCTCATCTGGTCACAGTGGTAGCCATGGAGGAGGAGGCATGGGCATGGGCGGCATGCTAGCTGGAG
GCGCAGCAGCTGCTGCCGCCGCTTACGGAGCACACAAGATTTCTCACGGCGGCCACGGTGGAGGTGGACACATGATGGGAGGCATGATGGGCGGCCATGG
AGGCTATGGCGGCGGGTACGGCCACCACGGCGGCAAGTTCAAGCACGGGAAGCACGGCCACGGCAAGTTCAAGCACGGCAAGCATGGGAAGCACGGCATG
TTCGGCGGCGGCGGAAAGTTCAAGAAGTGGAAGTAATGCGCTAGCTAGTAGCTTCACCATGGCTGATGAATCAAAAAAATACCTAAACTCTTCGTGTAGG
CTTCCAGAACTTGGTTTGGTCAGGGAAAGCCTTTGAGATGTATCTAAGCAGGGTGTGGTGTGGTTGCTGCCCGGATCTCGTGGAGCTTCCATCCTTTCCT
CTATATGATTTGGCACTCTAGTCTGCGTCT
page-top