Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2414
Contig Information
Length 1053 bp
Tissue Shoot grown with cold treatment
Clones 9 Clones [Download: CSV  ,  FASTA ]
whsc5b21    whsc14h21    whsc16o20    whsc8o15    rwhsc5b21    rwhsc11c17    rwhsc12d11    rwhsc14h21    rwhsc16o20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit mitogaligin [Homo sapiens]
Score 92
Evalue 0.335684
Total Hit Count 4
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2414
CTTATTAGAGCAAGTCATATCTTGTCACAGACGCAGACTAGAGTGCCAAATCATATAGAGGAAAGGATGGAAGCTCCACGAGATCCGGGCAGCAACCACA
CCACACCCTGCTTAGATACATCTCAAAGGCTTTCCCTGACCAAACCAAGTTCTGGAAGCCTACACGAAGAGTTTAGGTATTTTTTTGATTCATCAGCCAT
GGTGAAGCTACTAGCTAGCGCGCGCATTACTTCCACTTCTTGAACTTGCCGCCGCCGCCGAACATGCCGTGCTTCCCATGCTTGCCGTGCTTGAACTTGC
CGTGGCCGTGCTTCCCGTGCTTGAACTTGCCGCCGTGGTGGCCGTACCCGCCGCCATAGCCTCCATGGCCGCCCATCATGCCTCCCATCATGTGTCCACC
TCCACCGTGGCCGCCGTGAGAAATCTTGTGTGCTCCGTAAGCGGCGGCAGCAGCTGCTGCGCCTCCAGCTAGCATGCCGCCCATGCCCATGCCTCCTCCT
CCATGGCTACCACTGTGACCAGATGAGCCAGGGTAGCCAGCAGGGGGATAGCCATGCTGCTGTGGAGGGTAGCCATGCTGTTGCGGTGGGTAGCCATGCT
GAGGAGGGTAGCCTTGCTGAGGGTATCCATGCTGCTGCGGGGGGTACCCGTGGCCACCAGATGGGTAGCCATGGCCACCACCATGAGCACCGGCAACACC
GTGCATGATGTTGGAGAGGAGCCCCTTCTCCCCGTCACTGCCACCCGCTCCGGGTGCAGGAGGGTATGCCCCAGGTGCAGGAGGGTATGCCCCAGGTGCA
GGTGGGTAAGCTCCAGGTGCAGGCGGGTATCCTTGCTGTGGAGGGTAACCTCCCTGCTGCGGCGGGTACCCTTGCGGAGGGTATCCCCCCTGGCCACCGG
GTGGGTACCCATGACCGTCGTTGCCTCCTCCCATTGCTGTCGAGGGACTTAACTAGAGGACGAGAAGACCAGCGATTCTGCGAAGTTGAAGAAGAGGAAG
CAGCCGAGCCGATCTGGTTTGGCGGATGATGACGATCTCTTCCTCGTGCCGAA
page-top