Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig664
Contig Information
Length 1426 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv6e15    rwhkv6e15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0276100 [Oryza sativa (japonica cultivar-group)] >gi|6539562|dbj|BAA88179.1| putative isocitrate dehydrogenase [Oryza sativa Japonica Group] >gi|81686717|dbj|BAE48299.1| NAD-dependent isocitrate dehydrogenase a [Oryza sativa Japonica Group] >gi|113532256|dbj|BAF04639.1| Os01g0276100 [Oryza sativa (japonica cultivar-group)] >gi|125569901|gb|EAZ11416.1| hypothetical protein OsJ_001241 [Oryza sativa (japonica cultivar-group)] >gi|215765348|dbj|BAG87045.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1012
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig664
CCGCTCCCCGCCCCCTCCCCCCTCTCACCGCGGAGCCCATCCGCCGCCCGCCGCCGCCGCCGTTGACACTACCCGCGAATCTCCTTCTTCCGAGTGGTGG
AGAGGAGACATGGCACTCCGAAGGCTGCTTCAGGGGATTGTCCTACCGCGGACGACGGGCCGGCATGTTGGGGCATCGTTTTCCACGGAGGCTGGGGAGA
CTATCCGCGCAACCCTGTTTCCCGGTGATGGCATCGGGCCTGAGATCGCCGAGTCGGTCAAGCAGGTATTCAATGTTGCAGGTGTACCTATAGAATGGGA
AGAACATTATGTTGGTACGGAAGTTGATCCCAGAACAGAGAGCTTTTTGACATGGGAGAGCCTGGAGTCGGTGCGTAGAAACAAAGTTGGCTTGAAAGGT
CCTATGGCTACACCTATTGGAAAAGGCCACCGTTCTTTGAATCTTACATTAAGGAAAGAACTCGGACTCTACGCCAATGTCAGGCCTTGCAACAGCCTCC
CAGGCTACAAGACTAGATATGATGATGTGAACCTTGTGACAATCCGTGAAAATACTGAAGGAGAGTATAGTGGCCCTTGAGCATCAGGTTTGTGAGGGGT
GTTGTGGAAAGTTTGAAAATTATTACCCGCCAAGCAAGTTTGAGAGTGGCAGAGTATGCTTTCCATTATGCCAAAGCCAATGGCAGGGAGAGGGTCTCTG
CGATACATAAAGCTAATATCATGAGGAAAACAGACGGACTTTTCCTCAAGTGTTGCCGTGAAGTAGCTGAGAAGTACCCTGAAATCACATATGAGGAAGT
CATCATTGACAATTGCTGCATGACACTCGTGAAGAATCCTGGTACATTTGATGTATTAGTGATGCCAAATCTGTATGGTGACATTATTAGTGATCTATGT
GCTGGTTTGATCGGAGGCTTGGGCTTAACTCCCAGCTGCAACATTGGTGAAGGTGGCATTTGTCTGGCAGAGGCTGTTCATGGTTCTGCACCTGATATCT
CTGGCAAGAACCTTGCAAACCCAACTGCTCTTATGTTGAGTGCTGTTATGATGTTGCGCCACTTGCAATTCAATGACCAAGCAGACCGGATCCACAATGC
CATCCTCCAGACAATTGCCGAGGGGAAGTACAGAACCGCTGATCTTGGTGGGAAGTCATCAACATCAGACTACACAAAAGCAGTTTGCGATCATATCTGA
GCACCAGCTGCTCTTTCTGTCGATTATTTGTCTCCCACCTAATTTTGTTGCATACCAGGAGCTTTAGCCTGAGTAGGTGAAGTGGCAGGCACCTCGATTT
CCTTGGGTGTTAAGACACCGTTTAAGGCTCCTGAATAATCCTCGCATTCTTGTCCTTGGAAAAGTTTTACCAGCATTGCAGTCAAGCTGAAGAATCGTCT
GTAATAATCATTGGCAGCATCAGCGC
page-top