Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig5087  (registered. 2003)
Contig Information
Length 616 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit ubiquitin-conjugating enzyme [Lolium temulentum]
Score 592
Evalue 1.29531e-59
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig5087
AGAGACACCTTTTGAAGGTGGCGTATTTCAACTTGCATTCTCAATTCCCGAGCAGTATCCTCTACTGCCTCCGCAAGTCCGCTTCATCACCAAAATTTTC
CACCCAAATGTTCACTTCAAGACTGGTGAAATATGCCTGGATATATTGAAGAATGCATGGAGCCCTGCGTGGACCCTACAATCTGTTTGCAGAGCCATTA
TTGCGTTGATGGCCCATCCGGAAGCAGATAGCCCACTTAACTGCGACTCAGGCAATCTTCTCCGCTCGGGCGACATCAGAGGCTACCAGTCCATGGCGCG
GATGTACACCAGGCTAGCTGCCATGCCAAAGAAAGAGTGATTTGCAGGGTTGCAAAGGTACACCAGAGCAGTGGCGCTGGCGCTGGCTTATTGATTCATG
GATGTCGTATCCCCGTATCCCCGTAACCCCCTAAGTTGTCAGGTGCAACTCGTTGGTATCCCCGTATGAACTTGTGTGGCCTGATTTTCTTACCCGACTT
GTCGTTGTGGGTGTAATGTTGATTCTGTTGGGCTAAAAAGGATTTAAGCGTAAACGCTTGATTCATGATGATGTGTAATAAATAATCCTCACAGGGATTT
GGTAACAAAAAAAAAA
page-top