Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig469
Contig Information
Length 577 bp
Tissue Shoot with heat shock treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvh1m20    rwhvh1m20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit histone H4 [Zea mays]
Score 410
Evalue 1.42101e-38
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig469
CCCCATCCTCTCGCGGCTCGAACCAAGAAGAGATCTTCAGCCATGTCGGGGCGCGGCAAGGGAGGCAAGGGGCTCGGCAAGGGCGGCGCCAAGCGCCACA
GGAAGGTGCTGCGCGACAACATCCAGGGCATCACCAAGCCCGCCATCCGGCGCCTGGCGAGGAGGGGCGGCGTGAAGCGCATCTCCGGCCTCATCTACGA
GGAGACCCGCGGCGTGCTCAAGATCTTCCTCGAGAACGTCATCCGCGACGCCGTCACCTACACCGAGCACGCCCGCCGCAAGACTGTCACCGCCATGGAC
GTCGTCTACGCCCTCAAGCGCCAGGGTCGCACCCTCTACGGCTTCGGCGGCTAGGCTCTTCCTTGCCCCCTTGCAGATCCCAAAAGTTTGATGATACCGC
GACTTGTGTAGTTCTCTACTTCCTCTGTAGTTCGCTATTTCCTCTGTATTTCGAACTGAATCGTGGAGCAAACCTATTCGCAGTTTGTTAGAATTCAAAC
TTGTCTAAGTGAGATACCCGTGCCTCTGATTTTGTCCTGCTGCATCTCTGTTAATGTGAAATTGTTCANAAAAAAAA
page-top