Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhva13j08
Contig Information
Length 406 bp
Tissue Shoot with ABA treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhva13j08   
Homology (BLAST) Top Hit Os01g0971500 [Oryza sativa (japonica cultivar-group)] >gi|15289978|dbj|BAB63673.1| putative cytochrome b5 [Oryza sativa Japonica Group] >gi|113535065|dbj|BAF07448.1| Os01g0971500 [Oryza sativa (japonica cultivar-group)] >gi|125529283|gb|EAY77397.1| hypothetical protein OsI_05385 [Oryza sativa Indica Group] >gi|125573473|gb|EAZ14988.1| hypothetical protein OsJ_004813 [Oryza sativa (japonica cultivar-group)] >gi|149391361|gb|ABR25698.1| cytochrome b5 [Oryza sativa (indica cultivar-group)] >gi|149392595|gb|ABR26100.1| cytochrome b5 [Oryza sativa (indica cultivar-group)] >gi|215767969|dbj|BAH00198.1| unnamed protein product [Oryza sativa Japonica Group]
Score 164
Evalue 2.88376e-10
Total Hit Count 38
Registered year 2003
Contig Sequence     [ Download ]
>rwhva13j08
GTCTGAACATTCACCAGCGATATGGAAAATATAGCCAAGNATCTATCCGTTTTTCCCGAGTCNCGATTCAACAGCGGACGTCTTANCTATAACCATAACG
CANCGACGGGTCGAGAGCAGTTCCCAGATTCCATGACAGGACGGTGACGCTGGTACAAAATATGCAAATCCCCACTANAACTTATTCANCTCTTGGACAC
TTCCGAATGACTGACTGACTGGTATAAGATGACGGTGCTAGACAAAGTCTGCCTTGGTGTAGATCCGTACGGCGACGGCCAGGNCCANTATCGCGAGGGG
GACCAAGAACTGGAGGATCTTGATGACGAANTCNGGGGTCTTGTCCTGGTTGNAGTGCGGCTGCTTGGGCGGNGTGTACTTGACCTTGGNGGGTATNNTG
GTCNCG
page-top