Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23925  (registered. 2003)
Contig Information
Length 2085 bp
Clones 22 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 5
Wh_OKCS Seed DPA5 3
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 2
Wh_VSCB Liquid cultured tissue 4
Homology (BLAST) Top Hit Os02g0519900 [Oryza sativa (japonica cultivar-group)] >gi|49387779|dbj|BAD26337.1| putative elongation factor 2 [Oryza sativa Japonica Group] >gi|113536503|dbj|BAF08886.1| Os02g0519900 [Oryza sativa (japonica cultivar-group)] >gi|119395216|gb|ABL74569.1| elongation factor 2 [Oryza sativa (japonica cultivar-group)] >gi|125539668|gb|EAY86063.1| hypothetical protein OsI_07431 [Oryza sativa Indica Group] >gi|125582310|gb|EAZ23241.1| hypothetical protein OsJ_006724 [Oryza sativa (japonica cultivar-group)]
Score 3088
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23925
GCTGGTCTGCATGGGTGGGCTTTCACCCTTACAAACTTTGCTAAGATGTATGCCTCCAAGTTTGGAGTTGATGAGGCAAAGATGATGGAGAGGCTGTGGG
GTGAGAACTTCTTTGACCCAGCCACAAAGAAATGGACCTCCAAGAACACTGGGACAGCTACCTGCAAGAGAGGTTTCGTTCAGTTCTGCTATGAGCCAAT
CAAGCAAATCATAGCCACCTGCATGAATGACCAGAAGGATAAGTTGTGGCCTATGTTGAAGAAGCTTGGAGTGACCATGAAGAATGACGAGAAGGACTTG
ATGGGCAAGGCTCTCATGAAGCGTGTGATGCAAACTTGGCTGCCTGCCAGTCGTGCTCTGCTTGAGATGATGATATTTCACCTCCCCTCTCCTTCAAAGG
CCCAGAGGTACCGTGTGGAGAACTTATACGAGGGCCCCCTTGATGACATATATGCAAATGCTATCAGAAACTGTGACCCTGATGGTCCTCTTATGCTGTA
CGTCTCCAAGATGATTCCAGCATCTGACAAGGGTAGATTCTTTGCCTTTGGACGTGTTTTTGCCGGGAGGGTTGCAACTGGCATGAAGGTCCGTATCATG
GGTCCCAACTTTGTTCCTGGCCAGAAGAAGGATCTGTATGTGAAGAGTGTCCAGCGTACTGTTATCTGGATGGGAAAGAAGCAAGAGTCTGTTGAGGATG
TTCCCTGTGGTAACACTGTTGCTTTGGTTGGTTTGGATCAGTTCATCACAAAGAATGCAACCCTGACAAATGAGAAGGAAGTTGATGCCTGCCCAATCAG
GGCAATGAAGTTCTCTGTGTCCCCTGTTGTGCGTGTTGCTGTTCAGTGCAAGGTGGCCTCTGATCTTCCCAAGCTTGTTGAGGGTTTGAAGCGTCTGGCA
AAGTCTGACCCTATGGTTCTCTGTACCATTGAAGAGTCTGGTGAACATATCATTGCTGGAGCTGGAGAGCTTCACCTTGAAATCTGTTTGAAGGATCTGC
AGGATGACTTCATGGGTGGTGCTGAAATCATTGTTTCCCCTCCTGTCGTCTCCTTCCGTGAGACTGTTCTAGAGAAGTCCTGCCGTACAGTCATGAGCAA
GTCCCCGAACAAGCACAACCGTCTTTACATGGAAGCTCGCCCCTTGGAGGAGGGACTGGCTGAGGCCATTGATGATGGGCGCATTGGCCCACGTGACGAT
CCTAAGGTGCGGTCTAAGATCCTGTCTGAGGAGTTTGGCTGGGACAAGGATCTTGCCAAGAAGATTTGGTGCTTTGGACCTGAGACGACTGGCCCCAACA
TGGTTGTTGACATGTGTAAGGGAGTGCAGTATCTTAATGAAATCAAGGACTCTGTTGTGGCTGGGTTCCAGTGGGCGTCGAAGGAAGGTGCACTGGCTGA
GGAGAACATGCGTGGCATCTGCTTCGAGGTCTGTGATGTTGTTCTCCACACTGATGCTATTCACAGGGGTGGTGGTCAGGTCATTCCCACGGCCAGGAGG
GTCATTTATGCTTCTCAGCTGACTGCCAAGCCAAGGCTGCTGGAGCCTGTGTACCTGGTTGAAATCCAGGCCCCGGAGAATGCGCTTGGTGGCATCTATG
GTGTTCTGAATCAGAAGAGAGGGCACGTGTTCGAGGAGATGCAGAGGCAAGGTACCCCGCTCTACAACATCAAGGCCTACCTCCCCGTCATCGAGTCCTT
TGGGTTCTCAAGCACCCTGAGGGCTGCGACGTCCGGCCAGGCCTTCCCCCAGTGTGTGTTTGACCACTGGGACATCATGGCTTCCGATCCTTTGGACCCC
GGCACCCAGTCTGCGACGCTCGTCACGGAGATCCGCAAGAGGAAGGGGCTCAAGGAGCAGATGACCCCTCTATCCGATTTCGAAGACAAGCTCTAAATTT
TTGGTGCTGTTATCCCTTACCTGGTCTTGTGTTGTTAAAGAGAGCCGCACTATTTTGTATCGATGAGTCTTGCTGTTAATGACCTATTTGTCGTGATACT
GGGAACTATGTTTTGAGATGTCTGGTGATGTAACGGATGTTTTACTTAGATTATGTATCTGTTGTCCACTGGTTCAAAAAAAAAA
page-top