Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig1105
Contig Information
Length 873 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms17n22    rwhms17n22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein L3-B2 [Triticum aestivum] >gi|118152404|gb|ABK63946.1| ribosomal protein L3-B2 [Triticum aestivum] >gi|146141394|tpg|DAA01145.1| TPA_inf: ribosomal protein L3B-2 [Triticum aestivum]
Score 1317
Evalue 2.23203e-143
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig1105
AGTGATGCTGGCAAAAAAGAAATCCATATGCAGCTTGAGAAGATGAAGAAGTATGCTACTGTTGTCCGTGTTATCGCCCATACCCAGATCAGGAAGATGA
AGGGATTGAAGCAGAAGAAGGCTCACCTCATGGAGATCCAGATCAATGGTGGCACCATCGCCGATAAGGTTGACTATGGTTACAGCTTCTTTGAGAAGGA
AGTCCCTATTGATGCTGTGTTTCAAAAGGATGAGATGATTGACATCATTGGAGTTACCAAGGGTAAGGGTTACGAAGGTGTTGTGACACGTTGGGGTGTC
ACCCGTCTTCCCCGCAAGACCCACAGAGGTCTTCGCAAGGTTGCCTGTATTGGTGCCTGGCATCCTGCTAGGGTGTCCTACACTGTTGCTCGTGCTGGTC
AGAATGGTTACCACCACCGAACTGAGATGAACAAGAAGGTCTACAAGATTGGCAAGGTTGGACAGGAAACTCATGATGCCTCTACCGAGTTCGACAGGAC
TGAGAAGGACATCACTCCCATGGGTGGCTTCCCTCACTATGGTGTGGTGAAGGCTGACTACCTGATGATCAAGGGATGCTGTGTCGGCCCCAAGAAGCGG
GTGGTGACCCTCCGCCAGTCCCTGCTGAAGCAGACCTCTCGTCTGGCCCTGGAGGAGATCAAGCTCAAGTTCGTCGACACCTCTTCCAAGTTTGGGCACG
GTCGCTTCCAGACCACGGACGAGAAGCAGAGGTTCTACGGCAAGCTCAAGGCTTGAGCTGCTGCCCCGCATCATCAGTTGTATCATTTTGTCAAAACGAA
CATGTGATACTTGGTTACTTCCCCTGCCTAAGTTTTGTACTAGGTGATGTTTTCAGAATCTGGCTCATTCTAT
page-top