Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig465
Contig Information
Length 741 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n20g20    rwhv16n20g20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100216924 [Zea mays] >gi|194697072|gb|ACF82620.1| unknown [Zea mays] >gi|195621176|gb|ACG32418.1| cytochrome b5 [Zea mays]
Score 650
Evalue 3.6536e-66
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig465
CTCGCTTGACTCCTTGGAAGCAGAGAGAGGAGGAGGAGGAGGAGACCATGTCGTCGTCCGGTGGCAAGCTCTTCACCCTGGAGGAGGTCGCCAAGCACAG
CTCCAAGGACGACTGCTGGCTCGTCATCGGCGGCAAGGTGTACAATGTGACCAAGTTTCTTGATGACCACCCTGGAGGCGACGACGTCTTGCTGTCTTCA
ACTGCCAAGGACGCGACCGACGACTTCGAGGACGTGGGACACAGCACAACCGCCCGGGCGATGATGGACGAGTACTACGTCGGCGAGATCGACGCGACCA
CGATACCCACCAAGGTCAAGTACACGCCGCCCAAGCAGCCGCACTACAACCAGGACAAGACCCCCGAGTTCGTCATCAAGATCCTCCAGTTCTTGGTCCC
CCTCGCGATACTGGGCCTGGCCGTCGCCGTACGGATCTACACCAAGGCAGACTCTGTCTAGCACCGTCATCTTATACCAGTCAGTCAGTCATTCGGAAGT
GTCCAAGAGCTGAATAAGTTTTAGTGGGGATTTGCATATTTTGTACCAGCGTCACCGTCCTGTCATGGAATCTGGGAACTGCTCTCGACCCGTCGTTGCG
TTATGGTTCTACTAAGACGTCCGCTGTTGAATCGTGACTCGGGAAAAACGGATAGATACTTGGCTATATTTTCCATATCGCTGGTGAATGTTCAGACATA
CATATTCTTAATTTGATGTGATTAGTTGTGTAAAAAAAAAA
page-top