Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig1816
Contig Information
Length 678 bp
Tissue Shoot grown under continuous light
Clones 3 Clones [Download: CSV  ,  FASTA ]
whkp8l11    rwhkp8l11    rwhkp19o05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195659285|gb|ACG49110.1| 60S ribosomal protein L27a-3 [Zea mays]
Score 620
Evalue 9.22624e-63
Total Hit Count 409
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig1816
TTTTTTTTTTGATATAAACTGGCATAACATAGCGCAAAATTCTCATAAGATGTTGGTTTACCACACAGGAACCAGGATAACAAACTAACGATGTCTTCTT
CAACACAAATTGCTGGTACGGGAAACAACTAATAGTTCAGATATAGATCTCGGGGCACGGTCGGGAACAGAACCCTAGGCAACGAGCACGACTGCGCCGC
CGGCGGCCTTGATCTTCTTTTCGGCGATCTTGGAGATGAGCTTGGCCTTGACGACGATGGGCTTCTCCGGCAGCATCCCCTTGCCGAGCACCTTGAAGTA
GCCGAACTGCGAGACGTCGACCACGGGGGCCTTGTCGCCGCCGGCCTCCGCCGCCTTGTCGGACGGAACCATGGACCAGAGCCTCTCGACGTTGACCGTC
GGTGTGTAGAACCTGTTGCTGAGCTTGTGGAAGTAGCGCATACCGACCTTGCCGAAGTAGCCGGGATGGTACTTGTCGAAGAGGATGCGGTGGTGGTGCA
TGCCTCCGGCGTTACCGCGGCCTCCGGGATGCTTGCGGTGCTTGCCCACACGCCCGTGCCCGGCGGACACGTGGCCGCGCTTCTTCCGGTTCTTCTTGAA
GCGGGTCGTCATCGCCGCCGCTCGCTCGCTCGCCGCCGCCGCGGGCTTACCTTGGAGGAGAGGGGTCGGGACGGGTGG
page-top