Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig501
Contig Information
Length 458 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs19e20    rwhcs19e20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os12g0405700 [Oryza sativa (japonica cultivar-group)] >gi|113649135|dbj|BAF29647.1| Os12g0405700 [Oryza sativa (japonica cultivar-group)] >gi|218186712|gb|EEC69139.1| hypothetical protein OsI_38066 [Oryza sativa Indica Group]
Score 229
Evalue 8.30588e-18
Total Hit Count 16
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig501
CTTCACATCGGCGGCGGCGGCAGCGAAGAAGAAGAAGAGAAGAAGAAGAAAGATGATCTACGACGTGAACTCCCCCCTGTTCCGCTCCTTCCTCAGCCAG
AAGGGCGGCGCGTCCTCCGACAAGAGGAAAATGGAAGAGCAGAAGCCGAAAGACCAGAGGTTCAAGGCCAACGAGAACAAGCCTGTAATGAACGAATGAG
CATCGCCTGGACAGTCCGGTGCCTGCAAGGCCTAGCTGCCAATCATGTGACACTCCTATGTTAAAATGAGTGGTGTGAACATCTGCTTGGTCGTTCTGAA
AACTATCCAAGTATCCAGTACTGTGTTTTAAGTTCCTATATATCTGAACTGCATGCCTGGAATGATAAATTAGGAGATTTTATCTTGTGATGTCTTCTCA
TGGAGCATTCAAGTTTTGGAATCCACTTCCAGTTCCATATGGTGATTTAAAAAAAAAA
page-top