Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig155
Contig Information
Length 314 bp
Tissue Shoot with heat shock treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvh5n14    whvh6m01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Mcb1 protein [Hordeum vulgare subsp. vulgare] (no hit)
Score 670
Evalue 2.27916e-68
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig155
GCATGGGCATGGGTGGCATGCTGGCTGGAGGAGCAGCAGCTGCTGCCGCTGCTTACGGAGCACACAAGCTTTCTCACGGCGGCCACGGATGGAGGTGGAC
ACATGATGGGAGGCATGATGGGCGGCCACGGAGGCTACGGCGGCGGGTACGGCCACCACGGCGGTAAGTTCAAGCACGGGAAGCACGGCCACGGCAAGTT
CAAGCACGGCAAGCATGGGAAGCACGGCATGTTCGGCGGCGGCGGCAAGTTCAAGAAGTGGAAGTAATGCTGCTAGCTGGTAGCTTCACCATGGCTGATG
AATCAAAAAAAAAA
page-top