Sequence Cutter Result

Sequence
Chromosome Ver 1.0: chr1
Length 189
Location 4449774 - 4449962 (+)
Sequence AACATGGCGCTCTCCATCTCTCGATCGCCTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTA
CCTCGGATCGCGCTGGGGTTTGTGGCTTCTCGATCTTGTCGCTTGATTGCTCGGTGGGAG
GAGGGGTTTAAATAGGGGTGACGTGGGGGTGGAGTCTGGAAGGGAGTGGAAGGTTCGGAA
AGGTGGTGG
/rice/oryzabase