Sequence Cutter Result

Sequence
Chromosome Ver 1.0: chr1
Length 445
Location 4317903 - 4318347 (+)
Sequence CAGACGCTTTAATAGCTGGTATGTGCAAAATTTGGCAGATGTTCATAAATTTTGCTGCAA
TTACTGATCATGCATGGAAGAGTTTTTTTTTTTTTTTTGCGGGGAATCATGCATGGAAGA
GTTGACATTTACAGATGGGGACAGATATGATTTCTCACAATTTTTGACTCCAAAATTGGG
AGGAGGAGGAGGAGGAGAAGAAAAGGAGAGAAATTGAGAGAAAAAGAAAATCAAGAACGA
GAAAGCCACCGGTTTTCTCTCCGACGATCGCCGCCGCCGCCGCCGCCGCCGCTGCCGTCG
CCGTCGTCGTCGTCTACACGGCGACCCGCTGCAGCACCCTCGACGGGACGGCGAAGCGCG
CGGAGAAGGAGCGCGAGAGGTTCTCCGGCTCCACCCACGCCGCGCCGTCGTCGAAGTTCT
GCGCGTAGCTGTAGGCGTCGTAGGG
/rice/oryzabase