Sequence Cutter Result

Sequence
Chromosome Ver 1.0: chr1
Length 163
Location 302891 - 303053 (+)
Sequence ATGCAAGCATCTGCTTATGGATCTAAAGACAGAAATCCCAACTATGACGATAGTACAGAG
AGAGAGAGAGAGAGAGAGAGAGTTGCAGATGTCTCTTGATACTGAGTTGCCTTTGTAACT
TAACTACTGTAAGGAGGCATGGCATGGGAACAAAGTTACCAAC
/rice/oryzabase