Sequence Cutter Result

Sequence
Chromosome Ver 1.0: chr1
Length 146
Location 1659078 - 1659223 (+)
Sequence GATTTCGATCTGACTGTCCCTAGCTAGCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTGAT
GCACATGACCTTATCTAGTTGTTCTTTGTCCACGTTAATGTGTGTGTACAGTTAACAGTA
GATGCACAAGCAGCTGAGAAAGAAAG
/rice/oryzabase