Sequence Cutter Result

Sequence
Chromosome Build 5: chr1
Length 139
Location 4802644 - 4802782 (+)
Sequence CAGTCGCACTAACTGAACAACACCAAGTGCGCGAGGGCATCTGATCTCCTACAACTTTTG
CATTTCATATCGCGGATGGATGGATGGATGGATGGATATATATAGATGCGCCAAACCGAA
AGAAACTGATCTGTCCGTG
/rice/oryzabase