Sequence Cutter Result

Sequence
Chromosome Build 5: chr1
Length 220
Location 4432418 - 4432637 (+)
Sequence CATAGGCGCGCTTCTTAGCCGGGAGGCACAGAGCGAAACCGCCCCCCTCCACCGCCGCCG
CCGCCGCATAAGCCCGCTTCTTCGCCGGGAGGCAAACGGGGACGGCCGCCGCCGCCGCCG
CCGCCGCCTCCAGCATCGGCGGGCACAACCGCTTCCTCGCCGGCAGGCACGGCGCCATCC
CGAGACTGGAGCCGCCGACGTACTTGAACCGCTTGGAAGG
/rice/oryzabase